Incidental Mutation 'R5177:Nme7'
ID399541
Institutional Source Beutler Lab
Gene Symbol Nme7
Ensembl Gene ENSMUSG00000026575
Gene NameNME/NM23 family member 7
Synonymsnon-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase), nucleoside-diphosphate kinase, D530024H21Rik, Nm23-M7
MMRRC Submission 042757-MU
Accession Numbers

Genbank: NM_178071; MGI: 2449121

Is this an essential gene? Possibly essential (E-score: 0.707) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location164304121-164437725 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to G at 164380676 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 304 (Y304*)
Ref Sequence ENSEMBL: ENSMUSP00000141771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000191947] [ENSMUST00000193683] [ENSMUST00000193808]
Predicted Effect probably null
Transcript: ENSMUST00000191947
AA Change: Y304*
SMART Domains Protein: ENSMUSP00000141431
Gene: ENSMUSG00000026575
AA Change: Y304*

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193591
Predicted Effect probably null
Transcript: ENSMUST00000193683
AA Change: Y304*
SMART Domains Protein: ENSMUSP00000141963
Gene: ENSMUSG00000026575
AA Change: Y304*

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000193808
AA Change: Y304*
SMART Domains Protein: ENSMUSP00000141771
Gene: ENSMUSG00000026575
AA Change: Y304*

DomainStartEndE-ValueType
DM10 22 110 1.9e-37 SMART
NDK 110 248 1.75e-68 SMART
NDK 256 394 1.11e-43 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194694
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the non-metastatic expressed family of nucleoside diphosphate kinases. Members of this family are enzymes that catalyzes phosphate transfer from nucleoside triphosphates to nucleoside diphosphates. This protein contains two kinase domains, one of which is involved in autophosphorylation and the other may be inactive. This protein localizes to the centrosome and functions as a component of the gamma-tubulin ring complex which plays a role in microtubule organization. Mutations in this gene may be associated with venous thromboembolism. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mice exhibit hydrocephaly, domed skulls and 50% exhibit situs inversus. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(30)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Nme7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Nme7 APN 1 164345430 splice site probably null
IGL01662:Nme7 APN 1 164328297 missense probably benign 0.02
IGL01893:Nme7 APN 1 164345281 missense probably damaging 0.99
2107:Nme7 UTSW 1 164345353 missense possibly damaging 0.94
R0255:Nme7 UTSW 1 164345375 missense probably damaging 1.00
R3545:Nme7 UTSW 1 164385782 missense probably damaging 0.99
R4380:Nme7 UTSW 1 164345238 missense probably benign 0.35
R7454:Nme7 UTSW 1 164380648 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTGCCACTGTGGGTTTTATTAAG -3'
(R):5'- ACTCATCTGTTGGCCAATCG -3'

Sequencing Primer
(F):5'- TCTGAGGTAGAACAGCCACAAGTTC -3'
(R):5'- GTTGGCCAATCGCACTTG -3'
Posted On2016-07-06