Incidental Mutation 'R5177:Rabl6'
ID 399543
Institutional Source Beutler Lab
Gene Symbol Rabl6
Ensembl Gene ENSMUSG00000015087
Gene Name RAB, member RAS oncogene family-like 6
Synonyms Rbel1, Rbel1a, B230208H17Rik, Rbel1b
MMRRC Submission 042757-MU
Accession Numbers

Genbank: NM_001024616; MGI: 2442633

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5177 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 25583018-25608521 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25585373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 563 (M563V)
Ref Sequence ENSEMBL: ENSMUSP00000058746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000191602]
AlphaFold Q5U3K5
Predicted Effect probably benign
Transcript: ENSMUST00000058137
AA Change: M563V

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087
AA Change: M563V

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114217
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150206
Predicted Effect probably benign
Transcript: ENSMUST00000191602
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Meta Mutation Damage Score 0.1163 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small GTPases. The encoded protein binds to both GTP and GDP and may play a role in cell growth and survival. Overexpression of this gene may play a role in breast cancer tumorigenesis, and pseudogenes of this gene are located on the long arm of chromosome 2 and the short arm of chromosome 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Rabl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Rabl6 APN 2 25584120 unclassified probably benign
IGL00742:Rabl6 APN 2 25588687 missense probably damaging 0.96
IGL02231:Rabl6 APN 2 25598184 missense probably benign 0.41
IGL02424:Rabl6 APN 2 25587457 missense probably benign
IGL02514:Rabl6 APN 2 25608176 missense probably damaging 0.96
IGL03036:Rabl6 APN 2 25584856 missense probably benign 0.00
IGL03278:Rabl6 APN 2 25583822 unclassified probably benign
R0017:Rabl6 UTSW 2 25602567 splice site probably benign
R0269:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0442:Rabl6 UTSW 2 25587522 missense probably damaging 0.98
R0617:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0626:Rabl6 UTSW 2 25592766 critical splice donor site probably null
R1109:Rabl6 UTSW 2 25587526 missense probably damaging 1.00
R2034:Rabl6 UTSW 2 25585432 missense possibly damaging 0.59
R3914:Rabl6 UTSW 2 25588706 missense possibly damaging 0.91
R4255:Rabl6 UTSW 2 25584779 missense possibly damaging 0.91
R5389:Rabl6 UTSW 2 25588654 missense probably damaging 0.96
R6082:Rabl6 UTSW 2 25583825 unclassified probably benign
R6243:Rabl6 UTSW 2 25585403 missense probably damaging 0.98
R6430:Rabl6 UTSW 2 25584837 missense probably damaging 0.96
R6501:Rabl6 UTSW 2 25602447 missense possibly damaging 0.92
R7485:Rabl6 UTSW 2 25584141 missense unknown
R7839:Rabl6 UTSW 2 25592817 missense probably damaging 0.97
R7889:Rabl6 UTSW 2 25584774 critical splice donor site probably null
R8978:Rabl6 UTSW 2 25587529 missense probably damaging 1.00
R9106:Rabl6 UTSW 2 25596434 missense probably benign 0.01
R9439:Rabl6 UTSW 2 25602420 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGAACATTCTCCTGCCTCTCG -3'
(R):5'- TCCCAGAGTATGTCCAGCTG -3'

Sequencing Primer
(F):5'- TCTCGTCAGGCTCTGGGAAAC -3'
(R):5'- CCAGAGTATGTCCAGCTGAGGTG -3'
Posted On 2016-07-06