Mutagenetix > Incidental Mutations

Incidental Mutation 'R5177:Nostrin'

399545

Institutional Source

Beutler Lab

Gene Symbol

Nostrin

Ensembl Gene

ENSMUSG00000034738

Gene Name

nitric oxide synthase trafficker

Synonyms

mDaIP2

MMRRC Submission

042757-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R5177 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

69135800-69189330 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 69175754 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 261 (I261F)

Ref Sequence

ENSEMBL: ENSMUSP00000036923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041865]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041865
AA Change: I261F

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000036923
Gene: ENSMUSG00000034738
AA Change: I261F

Domain	Start	End	E-Value	Type
Pfam:FCH	13	88	4.9e-12	PFAM
low complexity region	135	146	N/A	INTRINSIC
coiled coil region	160	190	N/A	INTRINSIC
coiled coil region	305	334	N/A	INTRINSIC
low complexity region	419	439	N/A	INTRINSIC
SH3	441	496	8.89e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141276

Meta Mutation Damage Score

0.1733

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nitric oxide (NO) is a potent mediator in biologic processes such as neurotransmission, inflammatory response, and vascular homeostasis. NOSTRIN binds the enzyme responsible for NO production, endothelial NO synthase (ENOS; MIM 163729), and triggers the translocation of ENOS from the plasma membrane to vesicle-like subcellular structures, thereby attenuating ENOS-dependent NO production.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired retinal vascular angiogenesis, endothelial cell proliferation, endothelial cell migration and induced neovascularization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,285,295	R575Q	probably damaging	Het
AI464131	C	A	4: 41,498,407	E408*	probably null	Het
Arhgap22	T	G	14: 33,366,693	V377G	probably benign	Het
Asic4	T	C	1: 75,450,839	I3T	probably damaging	Het
Atp2b4	T	C	1: 133,728,768	T715A	probably benign	Het
Ccdc180	A	T	4: 45,917,508	H283L	probably damaging	Het
Cfb	A	G	17: 34,859,026	V976A	probably damaging	Het
Cltc	T	C	11: 86,705,163	T1250A	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dcbld1	T	A	10: 52,304,634	D131E	probably damaging	Het
Dmxl1	T	C	18: 49,893,584	S1920P	probably damaging	Het
Dnajc13	G	A	9: 104,230,986	H197Y	probably benign	Het
Dpy19l1	C	T	9: 24,438,628		probably null	Het
Ears2	A	G	7: 122,044,460		probably benign	Het
Epgn	A	C	5: 91,028,277		probably benign	Het
Ern1	T	C	11: 106,411,775	T418A	probably benign	Het
F12	G	A	13: 55,420,168	P476S	probably benign	Het
Gal3st2c	C	T	1: 94,009,208	Q292*	probably null	Het
Galnt7	C	A	8: 57,584,027	Q109H	possibly damaging	Het
Gimap1	G	T	6: 48,743,098	G215W	probably damaging	Het
Gm28042	T	A	2: 120,041,601		probably null	Het
Gm5414	A	G	15: 101,625,817	I284T	possibly damaging	Het
Hddc3	A	G	7: 80,343,166	E10G	probably damaging	Het
Hmgxb3	T	C	18: 61,172,194	K31E	probably damaging	Het
Hspg2	A	C	4: 137,518,772	Y989S	probably damaging	Het
Kif12	G	A	4: 63,167,904	T402M	probably benign	Het
Klhdc4	A	T	8: 121,813,790	L115*	probably null	Het
Lama2	C	T	10: 27,190,703	V1061M	possibly damaging	Het
Llgl1	C	T	11: 60,712,007	T836I	possibly damaging	Het
Maats1	A	G	16: 38,332,321	S176P	probably benign	Het
Map4k4	A	G	1: 39,986,762	D304G	probably damaging	Het
Matn2	A	G	15: 34,433,514	Q915R	possibly damaging	Het
Myo18a	A	G	11: 77,864,842		probably benign	Het
Nbn	A	T	4: 15,965,132		probably null	Het
Nek8	G	A	11: 78,170,471	Q383*	probably null	Het
Nme7	T	G	1: 164,380,676	Y304*	probably null	Het
Nol8	A	T	13: 49,661,112	H214L	probably benign	Het
Olfr46	A	G	7: 140,610,189	T8A	probably benign	Het
Olfr592	A	T	7: 103,187,503	I301L	probably benign	Het
Oprk1	T	G	1: 5,602,674	C345G	probably damaging	Het
Polrmt	T	C	10: 79,737,476	S998G	probably benign	Het
Ppp1r12c	T	A	7: 4,484,496	R393*	probably null	Het
Prpf3	T	A	3: 95,849,724		probably benign	Het
Rabl6	T	C	2: 25,585,373	M563V	probably benign	Het
Rasa2	C	A	9: 96,544,791	E775*	probably null	Het
Rc3h1	G	T	1: 160,951,652	V552L	probably damaging	Het
Rhot1	A	T	11: 80,246,766	N365Y	possibly damaging	Het
Rimbp3	G	A	16: 17,209,917	V402M	possibly damaging	Het
Rusc2	A	T	4: 43,421,805		probably null	Het
Slc25a11	T	C	11: 70,645,817	E141G	probably damaging	Het
Slc34a1	A	T	13: 55,401,162	I142F	probably damaging	Het
Socs6	A	C	18: 88,869,380	Y470*	probably null	Het
Sox12	A	T	2: 152,397,178	L174Q	unknown	Het
Srl	A	G	16: 4,496,403		probably null	Het
Tacc1	A	T	8: 25,201,221	V22E	probably damaging	Het
Thsd7a	A	T	6: 12,379,583	C947*	probably null	Het
Tlr12	A	C	4: 128,618,376	V27G	probably damaging	Het
Tmprss4	C	A	9: 45,173,962	V398L	probably benign	Het
Trip6	T	C	5: 137,312,172	D270G	probably damaging	Het
Uba5	T	G	9: 104,049,298	N355T	probably benign	Het
Ubr5	A	G	15: 38,006,517	Y1171H	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,018	L464P	possibly damaging	Het
Vmn2r57	A	G	7: 41,400,240	I695T	probably benign	Het
Vmn2r68	T	A	7: 85,221,991	I695L	probably damaging	Het
Vmn2r79	T	A	7: 87,001,969	M192K	probably damaging	Het
Vps16	G	T	2: 130,443,368	E782*	probably null	Het
Zfp783	A	G	6: 47,946,803		noncoding transcript	Het

Other mutations in Nostrin

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Nostrin	APN	2	69185554	splice site	probably benign
IGL00502:Nostrin	APN	2	69183992	missense	probably benign
IGL00767:Nostrin	APN	2	69175775	missense	probably benign	0.00
IGL00846:Nostrin	APN	2	69185555	splice site	probably benign
IGL00912:Nostrin	APN	2	69182819	splice site	probably benign
IGL02123:Nostrin	APN	2	69156109	splice site	probably benign
IGL02213:Nostrin	APN	2	69183918	missense	probably benign	0.25
R0295:Nostrin	UTSW	2	69179416	missense	probably benign	0.19
R0543:Nostrin	UTSW	2	69189131	makesense	probably null
R1384:Nostrin	UTSW	2	69189062	missense	probably benign	0.05
R1501:Nostrin	UTSW	2	69158785	missense	probably damaging	1.00
R1632:Nostrin	UTSW	2	69175734	missense	probably benign	0.21
R2012:Nostrin	UTSW	2	69144767	splice site	probably null
R2140:Nostrin	UTSW	2	69166003	missense	probably damaging	0.98
R2159:Nostrin	UTSW	2	69180922	splice site	probably null
R2329:Nostrin	UTSW	2	69161094	missense	probably damaging	1.00
R2890:Nostrin	UTSW	2	69180905	missense	probably benign
R4469:Nostrin	UTSW	2	69175717	missense	probably damaging	0.99
R4607:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4608:Nostrin	UTSW	2	69183899	missense	possibly damaging	0.89
R4684:Nostrin	UTSW	2	69183924	missense	probably benign	0.00
R4719:Nostrin	UTSW	2	69144812	nonsense	probably null
R4846:Nostrin	UTSW	2	69175579	missense	probably damaging	1.00
R4911:Nostrin	UTSW	2	69161142	missense	possibly damaging	0.87
R4987:Nostrin	UTSW	2	69156431	missense	probably benign
R5054:Nostrin	UTSW	2	69175713	missense	possibly damaging	0.82
R6561:Nostrin	UTSW	2	69180857	missense	probably benign
R6785:Nostrin	UTSW	2	69183927	missense	probably benign	0.01
R6789:Nostrin	UTSW	2	69175512	missense	probably benign
R7453:Nostrin	UTSW	2	69183896	missense	possibly damaging	0.95
R7465:Nostrin	UTSW	2	69185507	missense	possibly damaging	0.93
R7570:Nostrin	UTSW	2	69175806	missense	probably damaging	0.98
R7761:Nostrin	UTSW	2	69161122	missense	possibly damaging	0.88
R7802:Nostrin	UTSW	2	69189012	missense	probably benign	0.18
R8115:Nostrin	UTSW	2	69180920	critical splice donor site	probably null
R8160:Nostrin	UTSW	2	69179466	missense	probably damaging	0.98
X0021:Nostrin	UTSW	2	69144792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGACAAACGCTGACCACAG -3'
(R):5'- CGGTTGTAACTCGCGGATTG -3'

Sequencing Primer
(F):5'- CACAGTGAGTAGTGGAGACCTGTTTC -3'
(R):5'- GCCAAGATGAGCTGGTAA -3'

Posted On

2016-07-06