Mutagenetix > Incidental Mutation

Incidental Mutation 'R5177:Abcb11'

399547

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

042757-MU

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Essential gene?

Possibly essential (E-score: 0.590) question?

Stock #

R5177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 69285295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 575 (R575Q)

Ref Sequence

ENSEMBL: ENSMUSP00000137017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably damaging
Transcript: ENSMUST00000102709
AA Change: R575Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: R575Q

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102710
AA Change: R575Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: R575Q

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000180142
AA Change: R575Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: R575Q

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Meta Mutation Damage Score

0.2737

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI464131	C	A	4: 41,498,407	E408*	probably null	Het
Arhgap22	T	G	14: 33,366,693	V377G	probably benign	Het
Asic4	T	C	1: 75,450,839	I3T	probably damaging	Het
Atp2b4	T	C	1: 133,728,768	T715A	probably benign	Het
Ccdc180	A	T	4: 45,917,508	H283L	probably damaging	Het
Cfb	A	G	17: 34,859,026	V976A	probably damaging	Het
Cltc	T	C	11: 86,705,163	T1250A	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dcbld1	T	A	10: 52,304,634	D131E	probably damaging	Het
Dmxl1	T	C	18: 49,893,584	S1920P	probably damaging	Het
Dnajc13	G	A	9: 104,230,986	H197Y	probably benign	Het
Dpy19l1	C	T	9: 24,438,628		probably null	Het
Ears2	A	G	7: 122,044,460		probably benign	Het
Epgn	A	C	5: 91,028,277		probably benign	Het
Ern1	T	C	11: 106,411,775	T418A	probably benign	Het
F12	G	A	13: 55,420,168	P476S	probably benign	Het
Gal3st2c	C	T	1: 94,009,208	Q292*	probably null	Het
Galnt7	C	A	8: 57,584,027	Q109H	possibly damaging	Het
Gimap1	G	T	6: 48,743,098	G215W	probably damaging	Het
Gm28042	T	A	2: 120,041,601		probably null	Het
Gm5414	A	G	15: 101,625,817	I284T	possibly damaging	Het
Hddc3	A	G	7: 80,343,166	E10G	probably damaging	Het
Hmgxb3	T	C	18: 61,172,194	K31E	probably damaging	Het
Hspg2	A	C	4: 137,518,772	Y989S	probably damaging	Het
Kif12	G	A	4: 63,167,904	T402M	probably benign	Het
Klhdc4	A	T	8: 121,813,790	L115*	probably null	Het
Lama2	C	T	10: 27,190,703	V1061M	possibly damaging	Het
Llgl1	C	T	11: 60,712,007	T836I	possibly damaging	Het
Maats1	A	G	16: 38,332,321	S176P	probably benign	Het
Map4k4	A	G	1: 39,986,762	D304G	probably damaging	Het
Matn2	A	G	15: 34,433,514	Q915R	possibly damaging	Het
Myo18a	A	G	11: 77,864,842		probably benign	Het
Nbn	A	T	4: 15,965,132		probably null	Het
Nek8	G	A	11: 78,170,471	Q383*	probably null	Het
Nme7	T	G	1: 164,380,676	Y304*	probably null	Het
Nol8	A	T	13: 49,661,112	H214L	probably benign	Het
Nostrin	A	T	2: 69,175,754	I261F	possibly damaging	Het
Olfr46	A	G	7: 140,610,189	T8A	probably benign	Het
Olfr592	A	T	7: 103,187,503	I301L	probably benign	Het
Oprk1	T	G	1: 5,602,674	C345G	probably damaging	Het
Polrmt	T	C	10: 79,737,476	S998G	probably benign	Het
Ppp1r12c	T	A	7: 4,484,496	R393*	probably null	Het
Prpf3	T	A	3: 95,849,724		probably benign	Het
Rabl6	T	C	2: 25,585,373	M563V	probably benign	Het
Rasa2	C	A	9: 96,544,791	E775*	probably null	Het
Rc3h1	G	T	1: 160,951,652	V552L	probably damaging	Het
Rhot1	A	T	11: 80,246,766	N365Y	possibly damaging	Het
Rimbp3	G	A	16: 17,209,917	V402M	possibly damaging	Het
Rusc2	A	T	4: 43,421,805		probably null	Het
Slc25a11	T	C	11: 70,645,817	E141G	probably damaging	Het
Slc34a1	A	T	13: 55,401,162	I142F	probably damaging	Het
Socs6	A	C	18: 88,869,380	Y470*	probably null	Het
Sox12	A	T	2: 152,397,178	L174Q	unknown	Het
Srl	A	G	16: 4,496,403		probably null	Het
Tacc1	A	T	8: 25,201,221	V22E	probably damaging	Het
Thsd7a	A	T	6: 12,379,583	C947*	probably null	Het
Tlr12	A	C	4: 128,618,376	V27G	probably damaging	Het
Tmprss4	C	A	9: 45,173,962	V398L	probably benign	Het
Trip6	T	C	5: 137,312,172	D270G	probably damaging	Het
Uba5	T	G	9: 104,049,298	N355T	probably benign	Het
Ubr5	A	G	15: 38,006,517	Y1171H	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,018	L464P	possibly damaging	Het
Vmn2r57	A	G	7: 41,400,240	I695T	probably benign	Het
Vmn2r68	T	A	7: 85,221,991	I695L	probably damaging	Het
Vmn2r79	T	A	7: 87,001,969	M192K	probably damaging	Het
Vps16	G	T	2: 130,443,368	E782*	probably null	Het
Zfp783	A	G	6: 47,946,803		noncoding transcript	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1714:Abcb11	UTSW	2	69306581	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3772:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69261500	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7028:Abcb11	UTSW	2	69265675	missense	probably benign
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69303936	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69287594	splice site	probably null
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69265512	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69257410	intron	probably benign
R8964:Abcb11	UTSW	2	69286717	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69274150	missense
R9081:Abcb11	UTSW	2	69292044	missense	possibly damaging	0.59
R9093:Abcb11	UTSW	2	69239169	missense	probably damaging	0.97
R9228:Abcb11	UTSW	2	69308465	nonsense	probably null
R9294:Abcb11	UTSW	2	69265496	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCAACAGTGTCTTGTAGC -3'
(R):5'- CTTTCAGTAAAAGTTGGACCCG -3'

Sequencing Primer
(F):5'- CCAACAGTGTCTTGTAGCCATAAATC -3'
(R):5'- GTTGGACCCGTAAAAATTCACACTGG -3'

Posted On

2016-07-06