Incidental Mutation 'R5255:Slc22a30'
ID399548
Institutional Source Beutler Lab
Gene Symbol Slc22a30
Ensembl Gene ENSMUSG00000052562
Gene Namesolute carrier family 22, member 30
Synonyms
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location8335371-8405111 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 8344393 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 436 (Q436*)
Ref Sequence ENSEMBL: ENSMUSP00000114071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064507] [ENSMUST00000096269] [ENSMUST00000120540]
Predicted Effect probably benign
Transcript: ENSMUST00000064507
SMART Domains Protein: ENSMUSP00000069461
Gene: ENSMUSG00000052562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 439 3.1e-21 PFAM
Pfam:MFS_1 127 433 8.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096269
SMART Domains Protein: ENSMUSP00000093988
Gene: ENSMUSG00000052562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 527 9.6e-27 PFAM
Pfam:MFS_1 140 376 1.2e-15 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120540
AA Change: Q436*
SMART Domains Protein: ENSMUSP00000114071
Gene: ENSMUSG00000052562
AA Change: Q436*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 435 1.3e-20 PFAM
Pfam:MFS_1 127 435 1.5e-19 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Rnls A G 19: 33,382,423 V115A probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Slc22a30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Slc22a30 APN 19 8335788 missense probably benign 0.29
IGL01894:Slc22a30 APN 19 8386657 missense probably benign 0.28
IGL02795:Slc22a30 APN 19 8400895 missense probably damaging 1.00
IGL02798:Slc22a30 APN 19 8370085 missense probably damaging 0.96
IGL03267:Slc22a30 APN 19 8337958 missense probably benign 0.00
R0089:Slc22a30 UTSW 19 8370197 missense probably benign 0.03
R0243:Slc22a30 UTSW 19 8345357 missense probably benign 0.01
R1033:Slc22a30 UTSW 19 8335801 nonsense probably null
R1781:Slc22a30 UTSW 19 8335772 missense probably damaging 1.00
R2098:Slc22a30 UTSW 19 8400811 missense probably damaging 1.00
R3874:Slc22a30 UTSW 19 8336849 missense probably benign 0.31
R4091:Slc22a30 UTSW 19 8404545 missense probably damaging 1.00
R4799:Slc22a30 UTSW 19 8344404 missense probably benign
R5108:Slc22a30 UTSW 19 8386426 missense probably damaging 1.00
R5191:Slc22a30 UTSW 19 8344393 nonsense probably null
R5192:Slc22a30 UTSW 19 8344393 nonsense probably null
R5193:Slc22a30 UTSW 19 8344393 nonsense probably null
R5195:Slc22a30 UTSW 19 8344393 nonsense probably null
R5253:Slc22a30 UTSW 19 8344393 nonsense probably null
R5254:Slc22a30 UTSW 19 8344393 nonsense probably null
R5256:Slc22a30 UTSW 19 8344393 nonsense probably null
R5377:Slc22a30 UTSW 19 8344393 nonsense probably null
R5378:Slc22a30 UTSW 19 8344393 nonsense probably null
R5400:Slc22a30 UTSW 19 8344393 nonsense probably null
R5401:Slc22a30 UTSW 19 8344393 nonsense probably null
R5481:Slc22a30 UTSW 19 8336837 missense probably benign 0.01
R5644:Slc22a30 UTSW 19 8404616 missense possibly damaging 0.72
R5679:Slc22a30 UTSW 19 8335771 missense possibly damaging 0.90
R5699:Slc22a30 UTSW 19 8344393 nonsense probably null
R5704:Slc22a30 UTSW 19 8344393 nonsense probably null
R5706:Slc22a30 UTSW 19 8344393 nonsense probably null
R5767:Slc22a30 UTSW 19 8344393 nonsense probably null
R5770:Slc22a30 UTSW 19 8386527 missense probably damaging 0.99
R5784:Slc22a30 UTSW 19 8344393 nonsense probably null
R5793:Slc22a30 UTSW 19 8336819 missense possibly damaging 0.95
R5813:Slc22a30 UTSW 19 8404581 missense probably benign 0.07
R6101:Slc22a30 UTSW 19 8337868 splice site probably null
R6105:Slc22a30 UTSW 19 8337868 splice site probably null
R6327:Slc22a30 UTSW 19 8335722 utr 3 prime probably benign
R6958:Slc22a30 UTSW 19 8386701 missense probably damaging 0.98
R7162:Slc22a30 UTSW 19 8336717 splice site probably null
R7375:Slc22a30 UTSW 19 8404691 missense probably damaging 1.00
R7572:Slc22a30 UTSW 19 8335708 missense unknown
R7755:Slc22a30 UTSW 19 8336769 missense probably damaging 1.00
R8114:Slc22a30 UTSW 19 8404540 nonsense probably null
R8248:Slc22a30 UTSW 19 8370199 missense probably benign 0.12
Z1088:Slc22a30 UTSW 19 8335775 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATTAACAACCCAACTGGCATAC -3'
(R):5'- TGGTTCTCATGTCCCTGAGG -3'

Sequencing Primer
(F):5'- GGCATACATAGTACATACAGTTAGTC -3'
(R):5'- CCTCAAGGTAAGGAAAGAGT -3'
Posted On2016-07-06