Incidental Mutation 'R5177:Gm28042'
ID399549
Institutional Source Beutler Lab
Gene Symbol Gm28042
Ensembl Gene ENSMUSG00000033852
Gene Namepredicted gene, 28042
Synonyms
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R5177 (G1)
Quality Score223
Status Validated
Chromosome2
Chromosomal Location120027493-120043033 bp(+) (GRCm38)
Type of Mutationunclassified (6 bp from exon)
DNA Base Change (assembly) T to A at 120041601 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126150] [ENSMUST00000129685] [ENSMUST00000156805] [ENSMUST00000162393]
Predicted Effect probably benign
Transcript: ENSMUST00000126150
AA Change: F788I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118458
Gene: ENSMUSG00000098488
AA Change: F788I

DomainStartEndE-ValueType
C2 19 119 1.79e-17 SMART
PLAc 233 789 1.99e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129685
AA Change: F1011I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000115498
Gene: ENSMUSG00000033852
AA Change: F1011I

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 1012 1.99e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153571
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156159
SMART Domains Protein: ENSMUSP00000115974
Gene: ENSMUSG00000074899

DomainStartEndE-ValueType
SPEC 60 160 2.54e-6 SMART
SPEC 166 266 1.32e-13 SMART
SPEC 272 372 4.41e-15 SMART
SPEC 378 477 1.56e-15 SMART
SPEC 483 583 1.11e-11 SMART
SPEC 589 689 8.47e-26 SMART
SPEC 695 795 5.56e-12 SMART
SPEC 801 902 7.01e-9 SMART
SPEC 908 1032 4.44e-1 SMART
SPEC 1038 1138 3.73e-13 SMART
Pfam:Spectrin 1141 1206 2.2e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156805
SMART Domains Protein: ENSMUSP00000117535
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 308 1.65e-4 SMART
C2 242 342 1.79e-17 SMART
PLAc 456 892 8.56e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162393
SMART Domains Protein: ENSMUSP00000125329
Gene: ENSMUSG00000033852

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
JmjC 128 242 4.42e-3 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This locus represents naturally-occurring readthrough transcription between the neighboring Jmjd7 (jumonji domain containing 7) and Pla2g4b (phospholipase A2, group IVB (cytosolic)) genes on chromosome 2. The readthrough transcript is a candidate for nonsense-mediated mRNA decay (NMD), and is unlikely to produce a protein product. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Gm28042
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Gm28042 APN 2 120030356 missense probably damaging 1.00
IGL01148:Gm28042 APN 2 120039038 missense possibly damaging 0.74
IGL02005:Gm28042 APN 2 120034634 missense possibly damaging 0.95
IGL02237:Gm28042 APN 2 120039899 missense possibly damaging 0.61
IGL02539:Gm28042 APN 2 120035221 missense probably damaging 1.00
IGL02747:Gm28042 APN 2 120031394 missense probably damaging 1.00
IGL02825:Gm28042 APN 2 120031644 missense probably damaging 0.99
IGL02998:Gm28042 APN 2 120040154 missense possibly damaging 0.70
IGL03057:Gm28042 APN 2 120032156 missense probably damaging 1.00
IGL03084:Gm28042 APN 2 120040505 missense probably benign 0.08
IGL03160:Gm28042 APN 2 120035828 missense possibly damaging 0.94
PIT4520001:Gm28042 UTSW 2 120039667 nonsense probably null
R0147:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R0270:Gm28042 UTSW 2 120041592 missense probably benign 0.06
R0315:Gm28042 UTSW 2 120039057 missense probably damaging 1.00
R1421:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R1589:Gm28042 UTSW 2 120041406 missense probably benign 0.05
R1599:Gm28042 UTSW 2 120036463 missense probably benign 0.00
R1656:Gm28042 UTSW 2 120038889 missense probably damaging 1.00
R1718:Gm28042 UTSW 2 120036391 missense possibly damaging 0.78
R1969:Gm28042 UTSW 2 120041615 makesense probably null
R2164:Gm28042 UTSW 2 120036748 missense probably benign 0.01
R2275:Gm28042 UTSW 2 120036829 missense probably damaging 1.00
R3976:Gm28042 UTSW 2 120036756 missense probably benign 0.11
R4483:Gm28042 UTSW 2 120035840 missense possibly damaging 0.68
R4614:Gm28042 UTSW 2 120041158 missense probably damaging 0.99
R4802:Gm28042 UTSW 2 120042054 utr 3 prime probably benign
R4976:Gm28042 UTSW 2 120034643 missense probably damaging 1.00
R5119:Gm28042 UTSW 2 120034643 missense probably damaging 1.00
R5340:Gm28042 UTSW 2 120041448 missense probably benign
R5861:Gm28042 UTSW 2 120034635 missense probably damaging 1.00
R6641:Gm28042 UTSW 2 120039683 missense probably damaging 1.00
R7187:Gm28042 UTSW 2 120039695 missense probably damaging 1.00
R7488:Gm28042 UTSW 2 120039957 missense probably benign 0.00
R7699:Gm28042 UTSW 2 120039716 missense possibly damaging 0.81
R7700:Gm28042 UTSW 2 120039716 missense possibly damaging 0.81
X0019:Gm28042 UTSW 2 120039658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGTGAATCTGTCTTCTTCTGAC -3'
(R):5'- AGCTTCCAGCCTAGACTCTG -3'

Sequencing Primer
(F):5'- TTCTGACTCCCCATACCACTACAC -3'
(R):5'- TCCAGCCTAGACTCTGTGACAG -3'
Posted On2016-07-06