Incidental Mutation 'R5255:Rnls'
ID399550
Institutional Source Beutler Lab
Gene Symbol Rnls
Ensembl Gene ENSMUSG00000071573
Gene Namerenalase, FAD-dependent amine oxidase
Synonyms6530404N21Rik
MMRRC Submission 042826-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5255 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location33137747-33392295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33382423 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 115 (V115A)
Ref Sequence ENSEMBL: ENSMUSP00000093825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096114] [ENSMUST00000163093]
Predicted Effect probably damaging
Transcript: ENSMUST00000096114
AA Change: V115A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093825
Gene: ENSMUSG00000071573
AA Change: V115A

DomainStartEndE-ValueType
Pfam:Amino_oxidase 13 292 7.8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163093
SMART Domains Protein: ENSMUSP00000127592
Gene: ENSMUSG00000071573

DomainStartEndE-ValueType
PDB:3QJ4|B 1 182 1e-92 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Renalase is a flavin adenine dinucleotide-dependent amine oxidase that is secreted into the blood from the kidney (Xu et al., 2005 [PubMed 15841207]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit aggravated ischemic myocardial damage, increased heart rate, increased blood pressure and increased serum levels of dopamine, adrenaline and noradrenaline. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik A T 17: 33,066,765 C354* probably null Het
Abcf1 A T 17: 35,959,737 probably null Het
Abr T A 11: 76,455,683 E434V probably damaging Het
Acaca T A 11: 84,311,307 L197Q probably damaging Het
Acot10 A G 15: 20,665,932 I241T probably benign Het
Acp6 T C 3: 97,167,996 V182A probably benign Het
Ahnak2 G A 12: 112,773,378 T1420I possibly damaging Het
Akr1c6 A T 13: 4,447,019 K153N probably benign Het
Ank3 T C 10: 69,885,200 L600P probably damaging Het
Arhgef1 G A 7: 24,925,022 A824T probably damaging Het
B230307C23Rik T A 16: 98,008,691 N22K possibly damaging Het
Btn1a1 A G 13: 23,464,154 probably benign Het
Cenpf G A 1: 189,672,627 T352I possibly damaging Het
Ces4a C A 8: 105,142,489 F185L probably benign Het
Clybl A C 14: 122,384,279 E293A probably benign Het
Cobl A G 11: 12,375,825 W217R probably damaging Het
D430041D05Rik T C 2: 104,256,600 N677S probably benign Het
Ddx51 C A 5: 110,656,042 T390N possibly damaging Het
Drd5 T G 5: 38,319,967 V101G probably damaging Het
Elmo3 C T 8: 105,307,353 P244L probably benign Het
Esrrg G A 1: 188,146,358 R189H probably damaging Het
Fxr2 A G 11: 69,643,841 T183A probably benign Het
Gjd4 T C 18: 9,280,613 H155R probably benign Het
Hivep2 T A 10: 14,131,267 probably null Het
Ints10 T C 8: 68,793,972 probably benign Het
Kank4 T C 4: 98,778,972 T413A probably benign Het
Mapkbp1 T C 2: 120,017,254 V568A probably damaging Het
Mobp A G 9: 120,168,353 probably benign Het
Mpst A G 15: 78,410,508 S147G probably benign Het
Myo5b A T 18: 74,662,670 Y559F possibly damaging Het
Nceh1 T C 3: 27,183,139 I21T probably damaging Het
Olfr1303 T C 2: 111,814,178 K183E probably benign Het
Ralgps1 A T 2: 33,276,159 V126E probably damaging Het
Scn1a A T 2: 66,277,669 V1554D probably damaging Het
Slc16a11 T A 11: 70,215,432 D165E probably damaging Het
Slc16a5 A G 11: 115,462,675 T23A probably benign Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc3a1 A T 17: 85,028,453 probably null Het
Slitrk6 A T 14: 110,749,753 *841K probably null Het
Syngr1 A G 15: 80,091,446 Y18C possibly damaging Het
Tarbp1 T G 8: 126,428,970 D1343A probably benign Het
Vac14 T A 8: 110,634,329 I177N probably damaging Het
Vmn1r218 A T 13: 23,136,711 D76V possibly damaging Het
Wdr75 T A 1: 45,799,117 I62N probably damaging Het
Zfp12 A T 5: 143,240,379 I68L probably null Het
Zswim8 T A 14: 20,721,651 Y1551N probably damaging Het
Other mutations in Rnls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Rnls APN 19 33168488 missense probably benign 0.03
IGL01554:Rnls APN 19 33391099 missense possibly damaging 0.47
IGL02312:Rnls APN 19 33168383 missense probably benign 0.36
IGL02392:Rnls APN 19 33202612 missense possibly damaging 0.86
IGL02525:Rnls APN 19 33138214 missense possibly damaging 0.49
IGL02646:Rnls APN 19 33138284 splice site probably benign
IGL03097:Rnls APN 19 33138279 splice site probably benign
R1232:Rnls UTSW 19 33202646 missense probably benign 0.00
R1832:Rnls UTSW 19 33168495 missense possibly damaging 0.95
R1844:Rnls UTSW 19 33202531 missense possibly damaging 0.94
R2063:Rnls UTSW 19 33202544 missense probably benign 0.00
R6140:Rnls UTSW 19 33138200 missense probably damaging 1.00
R6986:Rnls UTSW 19 33382381 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCAGAAAGTAGGCCACAAGC -3'
(R):5'- AAGGTTGAGGAGCCTTTGTTCAC -3'

Sequencing Primer
(F):5'- GTAGGCCACAAGCAGTTTTAAAAC -3'
(R):5'- AGGAGCCTTTGTTCACTTGGATG -3'
Posted On2016-07-06