Incidental Mutation 'R5177:Vps16'
ID399551
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene NameVSP16 CORVET/HOPS core subunit
Synonyms
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location130424339-130444269 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 130443368 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 782 (E782*)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
Predicted Effect probably null
Transcript: ENSMUST00000028900
AA Change: E782*
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: E782*

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130437696 missense probably benign 0.19
IGL01400:Vps16 APN 2 130438353 missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130438394 missense probably damaging 0.97
IGL02011:Vps16 APN 2 130441479 missense probably benign 0.04
IGL02192:Vps16 APN 2 130440932 missense probably damaging 0.98
IGL02220:Vps16 APN 2 130441653 missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130439716 critical splice donor site probably null
R0427:Vps16 UTSW 2 130438850 missense probably benign 0.00
R0507:Vps16 UTSW 2 130437712 critical splice donor site probably null
R1550:Vps16 UTSW 2 130440340 missense probably benign 0.09
R1789:Vps16 UTSW 2 130443600 missense probably benign 0.42
R3895:Vps16 UTSW 2 130438676 missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130442594 missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130439912 missense probably damaging 1.00
R4555:Vps16 UTSW 2 130443576 missense probably damaging 1.00
R4569:Vps16 UTSW 2 130442204 missense probably benign
R4803:Vps16 UTSW 2 130438110 missense probably benign 0.27
R4835:Vps16 UTSW 2 130438300 splice site probably benign
R5022:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5023:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5057:Vps16 UTSW 2 130439452 missense probably benign 0.07
R5158:Vps16 UTSW 2 130441279 missense probably damaging 1.00
R5540:Vps16 UTSW 2 130442385 missense probably benign 0.00
R5680:Vps16 UTSW 2 130440324 missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130439091 nonsense probably null
R5690:Vps16 UTSW 2 130439091 nonsense probably null
R5926:Vps16 UTSW 2 130443556 missense probably damaging 0.97
R5992:Vps16 UTSW 2 130424449 critical splice donor site probably null
R6135:Vps16 UTSW 2 130438653 missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130443384 missense probably damaging 1.00
R6898:Vps16 UTSW 2 130437681 missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130438179 missense probably damaging 1.00
R7487:Vps16 UTSW 2 130439057 nonsense probably null
R7641:Vps16 UTSW 2 130440528 missense probably benign 0.28
R7720:Vps16 UTSW 2 130441703 nonsense probably null
R8246:Vps16 UTSW 2 130438873 missense probably damaging 1.00
R8363:Vps16 UTSW 2 130442241 missense probably benign 0.08
RF021:Vps16 UTSW 2 130438209 missense probably benign 0.09
Z1177:Vps16 UTSW 2 130441426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATTGTTTCCCCTAGGTGG -3'
(R):5'- CCAGTGCAGTGGGACAAAAC -3'

Sequencing Primer
(F):5'- AGGGGACTAGATATACTGACTGTAC -3'
(R):5'- AAAACGAGGCTCAGCTCTGTTTC -3'
Posted On2016-07-06