Incidental Mutation 'R5177:Vps16'
ID 399551
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms 1810074M16Rik
MMRRC Submission 042757-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.970) question?
Stock # R5177 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 130266259-130286189 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 130285288 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 782 (E782*)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000028900
AA Change: E782*
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: E782*

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,115,639 (GRCm39) R575Q probably damaging Het
Arhgap22 T G 14: 33,088,650 (GRCm39) V377G probably benign Het
Asic4 T C 1: 75,427,483 (GRCm39) I3T probably damaging Het
Atp2b4 T C 1: 133,656,506 (GRCm39) T715A probably benign Het
Bltp3a T C 17: 28,103,992 (GRCm39) L464P possibly damaging Het
Ccdc180 A T 4: 45,917,508 (GRCm39) H283L probably damaging Het
Cfap91 A G 16: 38,152,683 (GRCm39) S176P probably benign Het
Cfb A G 17: 35,078,002 (GRCm39) V976A probably damaging Het
Cltc T C 11: 86,595,989 (GRCm39) T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,180,730 (GRCm39) D131E probably damaging Het
Dmxl1 T C 18: 50,026,651 (GRCm39) S1920P probably damaging Het
Dnajc13 G A 9: 104,108,185 (GRCm39) H197Y probably benign Het
Dpy19l1 C T 9: 24,349,924 (GRCm39) probably null Het
Ears2 A G 7: 121,643,683 (GRCm39) probably benign Het
Epgn A C 5: 91,176,136 (GRCm39) probably benign Het
Ern1 T C 11: 106,302,601 (GRCm39) T418A probably benign Het
F12 G A 13: 55,567,981 (GRCm39) P476S probably benign Het
Gal3st2c C T 1: 93,936,930 (GRCm39) Q292* probably null Het
Galnt7 C A 8: 58,037,061 (GRCm39) Q109H possibly damaging Het
Gimap1 G T 6: 48,720,032 (GRCm39) G215W probably damaging Het
Gm28042 T A 2: 119,872,082 (GRCm39) probably null Het
Gm5414 A G 15: 101,534,252 (GRCm39) I284T possibly damaging Het
Hddc3 A G 7: 79,992,914 (GRCm39) E10G probably damaging Het
Hmgxb3 T C 18: 61,305,266 (GRCm39) K31E probably damaging Het
Hspg2 A C 4: 137,246,083 (GRCm39) Y989S probably damaging Het
Kif12 G A 4: 63,086,141 (GRCm39) T402M probably benign Het
Klhdc4 A T 8: 122,540,529 (GRCm39) L115* probably null Het
Lama2 C T 10: 27,066,699 (GRCm39) V1061M possibly damaging Het
Llgl1 C T 11: 60,602,833 (GRCm39) T836I possibly damaging Het
Map4k4 A G 1: 40,025,922 (GRCm39) D304G probably damaging Het
Matn2 A G 15: 34,433,660 (GRCm39) Q915R possibly damaging Het
Myo18a A G 11: 77,755,668 (GRCm39) probably benign Het
Myorg C A 4: 41,498,407 (GRCm39) E408* probably null Het
Nbn A T 4: 15,965,132 (GRCm39) probably null Het
Nek8 G A 11: 78,061,297 (GRCm39) Q383* probably null Het
Nme7 T G 1: 164,208,245 (GRCm39) Y304* probably null Het
Nol8 A T 13: 49,814,588 (GRCm39) H214L probably benign Het
Nostrin A T 2: 69,006,098 (GRCm39) I261F possibly damaging Het
Oprk1 T G 1: 5,672,897 (GRCm39) C345G probably damaging Het
Or13a18 A G 7: 140,190,102 (GRCm39) T8A probably benign Het
Or52j3 A T 7: 102,836,710 (GRCm39) I301L probably benign Het
Polrmt T C 10: 79,573,310 (GRCm39) S998G probably benign Het
Ppp1r12c T A 7: 4,487,495 (GRCm39) R393* probably null Het
Prpf3 T A 3: 95,757,036 (GRCm39) probably benign Het
Rabl6 T C 2: 25,475,385 (GRCm39) M563V probably benign Het
Rasa2 C A 9: 96,426,844 (GRCm39) E775* probably null Het
Rc3h1 G T 1: 160,779,222 (GRCm39) V552L probably damaging Het
Rhot1 A T 11: 80,137,592 (GRCm39) N365Y possibly damaging Het
Rimbp3 G A 16: 17,027,781 (GRCm39) V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 (GRCm39) probably null Het
Slc25a11 T C 11: 70,536,643 (GRCm39) E141G probably damaging Het
Slc34a1 A T 13: 55,548,975 (GRCm39) I142F probably damaging Het
Socs6 A C 18: 88,887,504 (GRCm39) Y470* probably null Het
Sox12 A T 2: 152,239,098 (GRCm39) L174Q unknown Het
Srl A G 16: 4,314,267 (GRCm39) probably null Het
Tacc1 A T 8: 25,691,237 (GRCm39) V22E probably damaging Het
Thsd7a A T 6: 12,379,582 (GRCm39) C947* probably null Het
Tlr12 A C 4: 128,512,169 (GRCm39) V27G probably damaging Het
Tmprss4 C A 9: 45,085,260 (GRCm39) V398L probably benign Het
Trip6 T C 5: 137,310,434 (GRCm39) D270G probably damaging Het
Uba5 T G 9: 103,926,497 (GRCm39) N355T probably benign Het
Ubr5 A G 15: 38,006,761 (GRCm39) Y1171H probably benign Het
Vmn2r57 A G 7: 41,049,664 (GRCm39) I695T probably benign Het
Vmn2r68 T A 7: 84,871,199 (GRCm39) I695L probably damaging Het
Vmn2r79 T A 7: 86,651,177 (GRCm39) M192K probably damaging Het
Zfp783 A G 6: 47,923,737 (GRCm39) noncoding transcript Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130,279,616 (GRCm39) missense probably benign 0.19
IGL01400:Vps16 APN 2 130,280,273 (GRCm39) missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130,280,314 (GRCm39) missense probably damaging 0.97
IGL02011:Vps16 APN 2 130,283,399 (GRCm39) missense probably benign 0.04
IGL02192:Vps16 APN 2 130,282,852 (GRCm39) missense probably damaging 0.98
IGL02220:Vps16 APN 2 130,283,573 (GRCm39) missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130,281,636 (GRCm39) critical splice donor site probably null
R0427:Vps16 UTSW 2 130,280,770 (GRCm39) missense probably benign 0.00
R0507:Vps16 UTSW 2 130,279,632 (GRCm39) critical splice donor site probably null
R1550:Vps16 UTSW 2 130,282,260 (GRCm39) missense probably benign 0.09
R1789:Vps16 UTSW 2 130,285,520 (GRCm39) missense probably benign 0.42
R3895:Vps16 UTSW 2 130,280,596 (GRCm39) missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130,284,514 (GRCm39) missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130,281,832 (GRCm39) missense probably damaging 1.00
R4555:Vps16 UTSW 2 130,285,496 (GRCm39) missense probably damaging 1.00
R4569:Vps16 UTSW 2 130,284,124 (GRCm39) missense probably benign
R4803:Vps16 UTSW 2 130,280,030 (GRCm39) missense probably benign 0.27
R4835:Vps16 UTSW 2 130,280,220 (GRCm39) splice site probably benign
R5022:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5023:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5057:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5158:Vps16 UTSW 2 130,283,199 (GRCm39) missense probably damaging 1.00
R5540:Vps16 UTSW 2 130,284,305 (GRCm39) missense probably benign 0.00
R5680:Vps16 UTSW 2 130,282,244 (GRCm39) missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5690:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5926:Vps16 UTSW 2 130,285,476 (GRCm39) missense probably damaging 0.97
R5992:Vps16 UTSW 2 130,266,369 (GRCm39) critical splice donor site probably null
R6135:Vps16 UTSW 2 130,280,573 (GRCm39) missense possibly damaging 0.57
R6370:Vps16 UTSW 2 130,285,304 (GRCm39) missense probably damaging 1.00
R6898:Vps16 UTSW 2 130,279,601 (GRCm39) missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130,280,099 (GRCm39) missense probably damaging 1.00
R7487:Vps16 UTSW 2 130,280,977 (GRCm39) nonsense probably null
R7641:Vps16 UTSW 2 130,282,448 (GRCm39) missense probably benign 0.28
R7720:Vps16 UTSW 2 130,283,623 (GRCm39) nonsense probably null
R8246:Vps16 UTSW 2 130,280,793 (GRCm39) missense probably damaging 1.00
R8363:Vps16 UTSW 2 130,284,161 (GRCm39) missense probably benign 0.08
R9092:Vps16 UTSW 2 130,281,593 (GRCm39) missense probably damaging 0.99
R9128:Vps16 UTSW 2 130,266,319 (GRCm39) missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130,283,823 (GRCm39) critical splice donor site probably null
R9406:Vps16 UTSW 2 130,283,425 (GRCm39) critical splice donor site probably null
R9508:Vps16 UTSW 2 130,284,361 (GRCm39) missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130,282,405 (GRCm39) missense probably benign 0.02
RF021:Vps16 UTSW 2 130,280,129 (GRCm39) missense probably benign 0.09
Z1177:Vps16 UTSW 2 130,283,346 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATATTGTTTCCCCTAGGTGG -3'
(R):5'- CCAGTGCAGTGGGACAAAAC -3'

Sequencing Primer
(F):5'- AGGGGACTAGATATACTGACTGTAC -3'
(R):5'- AAAACGAGGCTCAGCTCTGTTTC -3'
Posted On 2016-07-06