Incidental Mutation 'R5256:Prox1'
ID399567
Institutional Source Beutler Lab
Gene Symbol Prox1
Ensembl Gene ENSMUSG00000010175
Gene Nameprospero homeobox 1
SynonymsA230003G05Rik
MMRRC Submission 042827-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5256 (G1)
Quality Score222
Status Validated
Chromosome1
Chromosomal Location190118035-190170714 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 190161441 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 269 (D269G)
Ref Sequence ENSEMBL: ENSMUSP00000135066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010319] [ENSMUST00000175916] [ENSMUST00000177288]
Predicted Effect probably benign
Transcript: ENSMUST00000010319
AA Change: D269G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000010319
Gene: ENSMUSG00000010175
AA Change: D269G

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175916
AA Change: D269G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135703
Gene: ENSMUSG00000010175
AA Change: D269G

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 578 735 8.9e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177288
AA Change: D269G

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135066
Gene: ENSMUSG00000010175
AA Change: D269G

DomainStartEndE-ValueType
low complexity region 208 223 N/A INTRINSIC
SCOP:d1fxkc_ 227 363 9e-5 SMART
low complexity region 514 526 N/A INTRINSIC
low complexity region 529 545 N/A INTRINSIC
Pfam:HPD 579 732 2.2e-86 PFAM
Meta Mutation Damage Score 0.0744 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the homeobox transcription factor family. Members of this family contain a homeobox domain that consists of a 60-amino acid helix-turn-helix structure that binds DNA and RNA. The protein encoded by this gene is conserved across vertebrates and may play an essential role during development. Altered levels of this protein have been reported in cancers of different organs, such as colon, brain, blood, breast, pancreas, liver and esophagus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality with impaired development of the lens, lymphatic system, liver and pancreas. Heterozygous mutation results in early postnatal lethality with varying penetrance on different genetic backgrounds, obesity and lymphatic vessel abnormalities [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730015C16Rik C A 4: 108,848,065 probably benign Het
Actr1b T C 1: 36,700,092 H372R probably benign Het
Ampd2 C A 3: 108,079,549 probably benign Het
Anapc4 A G 5: 52,863,594 S612G probably benign Het
Arhgef7 T C 8: 11,800,811 L141P probably damaging Het
Atl1 A G 12: 69,959,333 D471G probably damaging Het
Atrn A G 2: 130,946,019 D247G probably benign Het
Bag1 T A 4: 40,948,022 R61W probably damaging Het
Card10 C T 15: 78,778,251 R898H probably damaging Het
Cct6b G A 11: 82,764,220 A3V probably damaging Het
Cfap54 A T 10: 92,935,091 L2097* probably null Het
Cfap54 T C 10: 93,045,023 probably null Het
Chd5 T C 4: 152,372,097 F964L probably benign Het
Cog5 A G 12: 31,886,205 T584A probably benign Het
Cpa2 T A 6: 30,547,197 N157K probably damaging Het
Cpeb1 A T 7: 81,351,839 M440K probably damaging Het
Cracr2a G A 6: 127,604,029 C56Y probably damaging Het
Ddb2 A C 2: 91,236,728 L30R probably damaging Het
Dlk1 T A 12: 109,459,771 I190N probably damaging Het
Dnajc13 T A 9: 104,203,329 Y851F possibly damaging Het
Dopey1 T A 9: 86,515,328 L895Q probably damaging Het
Dyx1c1 T C 9: 72,972,080 probably null Het
F7 G A 8: 13,030,763 C122Y probably damaging Het
Frrs1 T C 3: 116,903,100 V573A possibly damaging Het
Gm17541 A T 12: 4,689,672 probably benign Het
Gm20388 T C 8: 122,270,436 probably benign Het
Gm5519 A T 19: 33,823,176 H90L probably damaging Het
Gm5526 T A 1: 45,857,409 noncoding transcript Het
Gm5709 A T 3: 59,602,550 noncoding transcript Het
Golga4 T A 9: 118,556,501 V869D possibly damaging Het
Grm7 A T 6: 111,358,221 Q531L probably benign Het
Hnrnpu C A 1: 178,335,893 C265F unknown Het
Hoxd3 G A 2: 74,746,867 V364I possibly damaging Het
Hspb8 T C 5: 116,409,473 D150G probably damaging Het
Hydin C A 8: 110,587,223 N4244K possibly damaging Het
Ik A G 18: 36,748,873 D136G probably benign Het
Il11ra1 T C 4: 41,767,932 probably benign Het
Jph1 T C 1: 17,091,398 I347V probably benign Het
Klk1 T A 7: 44,221,561 probably benign Het
Lmcd1 T A 6: 112,288,126 probably benign Het
Lnx1 C T 5: 74,685,654 C45Y probably damaging Het
Macc1 T A 12: 119,446,529 M344K possibly damaging Het
Madcam1 A G 10: 79,664,945 E32G possibly damaging Het
Mat2a T C 6: 72,434,333 D383G probably benign Het
Mpst T A 15: 78,413,649 I289N probably damaging Het
Myh6 C T 14: 54,952,661 R1055Q probably damaging Het
Myh7 T C 14: 54,979,508 K1131E probably damaging Het
Ndrg3 A T 2: 156,931,205 probably benign Het
Nebl A G 2: 17,433,975 S209P probably benign Het
Nid2 A G 14: 19,768,208 probably null Het
Nup188 A T 2: 30,330,749 S945C probably damaging Het
Olfr1000 C T 2: 85,608,473 V146I probably benign Het
Olfr251 A G 9: 38,377,917 N12S probably benign Het
Olfr50 A G 2: 36,793,673 M146V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Patl2 A G 2: 122,128,887 L32P probably damaging Het
Pcdh20 T A 14: 88,468,377 M496L probably benign Het
Pdzd2 A G 15: 12,372,942 V2369A possibly damaging Het
Pfn2 A G 3: 57,847,391 V31A probably damaging Het
Plxna4 T C 6: 32,251,072 N533S probably benign Het
Plxnb1 T C 9: 109,114,593 F1916S probably damaging Het
Ppp4r3b T C 11: 29,188,293 F214L probably benign Het
Rapgef4 T C 2: 72,034,034 F71S probably damaging Het
Rft1 A G 14: 30,661,286 I94M probably benign Het
S100z T C 13: 95,478,619 I13V probably damaging Het
Serhl T A 15: 83,102,634 V117E probably damaging Het
Shroom1 G A 11: 53,465,507 R336Q probably benign Het
Sik3 A T 9: 46,212,254 Q1067L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc28a1 G A 7: 81,122,121 V118M probably damaging Het
Slco1a6 T A 6: 142,132,701 I153F probably benign Het
Ss18l1 T C 2: 180,061,942 Y323H unknown Het
Susd4 G T 1: 182,892,259 A480S possibly damaging Het
Syne3 A T 12: 104,975,880 M1K probably null Het
Synpo2l A T 14: 20,661,014 S513T probably benign Het
Tat A T 8: 109,998,334 N388I probably benign Het
Tbc1d1 A G 5: 64,282,009 Y619C probably damaging Het
Tbk1 G A 10: 121,570,685 T216M probably damaging Het
Tns1 C T 1: 73,995,426 probably benign Het
Trbv5 T C 6: 41,062,384 V9A possibly damaging Het
Trpm5 A G 7: 143,082,303 Y575H probably damaging Het
Ttn A T 2: 76,739,701 Y25203* probably null Het
Tubb3 C A 8: 123,421,652 D441E probably benign Het
Usp33 T A 3: 152,391,696 C850* probably null Het
Vdac1 G A 11: 52,384,078 probably null Het
Vmn1r232 T C 17: 20,913,584 I251M probably damaging Het
Vmn2r11 T G 5: 109,054,792 I140L probably benign Het
Vmn2r6 A T 3: 64,556,842 N190K probably benign Het
Vps51 T A 19: 6,070,488 H465L probably benign Het
Zfp318 T G 17: 46,412,069 I1666S probably benign Het
Zfp446 C T 7: 12,979,304 R90* probably null Het
Zgrf1 T A 3: 127,602,445 F547I probably damaging Het
Other mutations in Prox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Prox1 APN 1 190123410 splice site probably benign
IGL01729:Prox1 APN 1 190161175 missense probably benign
IGL02167:Prox1 APN 1 190161280 missense probably benign 0.13
IGL02416:Prox1 APN 1 190161130 missense probably benign 0.00
IGL02419:Prox1 APN 1 190161130 missense probably benign 0.00
IGL03234:Prox1 APN 1 190161636 missense probably damaging 1.00
R0069:Prox1 UTSW 1 190160919 missense possibly damaging 0.85
R0514:Prox1 UTSW 1 190161456 missense probably damaging 0.99
R1249:Prox1 UTSW 1 190147061 missense possibly damaging 0.94
R1299:Prox1 UTSW 1 190146943 splice site probably benign
R1601:Prox1 UTSW 1 190161006 missense probably damaging 0.99
R1893:Prox1 UTSW 1 190160518 splice site probably benign
R2090:Prox1 UTSW 1 190160812 missense probably damaging 0.99
R2366:Prox1 UTSW 1 190161882 missense probably damaging 0.96
R4614:Prox1 UTSW 1 190162008 missense probably damaging 0.99
R4799:Prox1 UTSW 1 190153472 missense probably damaging 0.98
R4873:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R4875:Prox1 UTSW 1 190162122 missense probably damaging 0.99
R5124:Prox1 UTSW 1 190161279 missense possibly damaging 0.73
R5149:Prox1 UTSW 1 190147053 missense possibly damaging 0.89
R5545:Prox1 UTSW 1 190147142 missense probably damaging 1.00
R5985:Prox1 UTSW 1 190146955 missense possibly damaging 0.93
R5993:Prox1 UTSW 1 190162239 missense probably damaging 1.00
R6833:Prox1 UTSW 1 190160778 missense probably damaging 0.99
R7335:Prox1 UTSW 1 190161845 missense possibly damaging 0.93
R7385:Prox1 UTSW 1 190162126 missense probably benign
R7572:Prox1 UTSW 1 190123386 missense probably benign 0.10
R7608:Prox1 UTSW 1 190153445 missense probably benign 0.24
R7655:Prox1 UTSW 1 190162221 missense probably damaging 0.99
R7656:Prox1 UTSW 1 190162221 missense probably damaging 0.99
Z1088:Prox1 UTSW 1 190161999 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCGCTTAGGCTTGTTCTCAG -3'
(R):5'- TGTGGCATTAAGGGGCAATG -3'

Sequencing Primer
(F):5'- AGGCTTGTTCTCAGCCATC -3'
(R):5'- TCTGTGAGTCCCCGAGAAAGTTAC -3'
Posted On2016-07-06