Incidental Mutation 'R5177:Trip6'
ID399572
Institutional Source Beutler Lab
Gene Symbol Trip6
Ensembl Gene ENSMUSG00000023348
Gene Namethyroid hormone receptor interactor 6
Synonyms
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location137309654-137314404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137312172 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 270 (D270G)
Ref Sequence ENSEMBL: ENSMUSP00000024119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024119] [ENSMUST00000039991] [ENSMUST00000040873] [ENSMUST00000197466] [ENSMUST00000197484] [ENSMUST00000198526] [ENSMUST00000199121] [ENSMUST00000199243]
Predicted Effect probably damaging
Transcript: ENSMUST00000024119
AA Change: D270G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024119
Gene: ENSMUSG00000023348
AA Change: D270G

DomainStartEndE-ValueType
low complexity region 155 171 N/A INTRINSIC
low complexity region 222 234 N/A INTRINSIC
low complexity region 239 262 N/A INTRINSIC
LIM 282 335 4.59e-14 SMART
LIM 342 394 1.41e-14 SMART
LIM 402 464 5.65e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000039991
SMART Domains Protein: ENSMUSP00000038106
Gene: ENSMUSG00000037344

DomainStartEndE-ValueType
Pfam:AA_permease 42 536 1.8e-114 PFAM
Pfam:SLC12 545 639 4.6e-13 PFAM
low complexity region 804 817 N/A INTRINSIC
low complexity region 845 866 N/A INTRINSIC
low complexity region 871 888 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040873
SMART Domains Protein: ENSMUSP00000043123
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 153 262 3.8e-44 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 645 850 9.7e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197466
SMART Domains Protein: ENSMUSP00000142564
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 845 5.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197484
SMART Domains Protein: ENSMUSP00000142660
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 41 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198216
Predicted Effect probably benign
Transcript: ENSMUST00000198526
SMART Domains Protein: ENSMUSP00000142435
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 2e-45 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 322 347 N/A INTRINSIC
low complexity region 369 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199121
Predicted Effect probably benign
Transcript: ENSMUST00000199243
SMART Domains Protein: ENSMUSP00000143232
Gene: ENSMUSG00000037364

DomainStartEndE-ValueType
low complexity region 3 65 N/A INTRINSIC
low complexity region 95 116 N/A INTRINSIC
Pfam:DUF3546 151 264 9.5e-48 PFAM
low complexity region 269 276 N/A INTRINSIC
low complexity region 326 350 N/A INTRINSIC
coiled coil region 367 402 N/A INTRINSIC
Blast:RRM 421 491 2e-31 BLAST
low complexity region 566 595 N/A INTRINSIC
low complexity region 603 615 N/A INTRINSIC
Pfam:ARS2 635 849 9.8e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199564
Meta Mutation Damage Score 0.0858 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the zyxin family and encodes a protein with three LIM zinc-binding domains. This protein localizes to focal adhesion sites and along actin stress fibers. Recruitment of this protein to the plasma membrane occurs in a lysophosphatidic acid (LPA)-dependent manner and it regulates LPA-induced cell migration. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Trip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Trip6 APN 5 137313413 missense probably benign 0.02
IGL02330:Trip6 APN 5 137313358 missense probably benign 0.01
IGL02471:Trip6 APN 5 137310356 missense probably benign 0.45
IGL03171:Trip6 APN 5 137312884 missense probably benign 0.01
R0058:Trip6 UTSW 5 137310845 unclassified probably benign
R0139:Trip6 UTSW 5 137312174 missense probably benign 0.01
R0270:Trip6 UTSW 5 137312841 missense probably benign
R0464:Trip6 UTSW 5 137313681 missense probably damaging 1.00
R0735:Trip6 UTSW 5 137310821 missense probably benign 0.07
R1169:Trip6 UTSW 5 137311920 missense probably benign 0.09
R3917:Trip6 UTSW 5 137313679 missense probably benign 0.40
R4774:Trip6 UTSW 5 137310171 missense probably damaging 1.00
R7008:Trip6 UTSW 5 137312966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAATATGGAAGACACGGTCC -3'
(R):5'- AGGTCAAGGATCAAGATGTCC -3'

Sequencing Primer
(F):5'- AAGACACGGTCCAGGGC -3'
(R):5'- TCCAAAGGGAAGGGGCTTC -3'
Posted On2016-07-06