Incidental Mutation 'R5177:Vmn2r68'
ID 399588
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms EG620697, Vmn2r68-ps
MMRRC Submission 042757-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R5177 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 84870726-84886912 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84871199 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 695 (I695L)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably damaging
Transcript: ENSMUST00000061074
AA Change: I695L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: I695L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,115,639 (GRCm39) R575Q probably damaging Het
Arhgap22 T G 14: 33,088,650 (GRCm39) V377G probably benign Het
Asic4 T C 1: 75,427,483 (GRCm39) I3T probably damaging Het
Atp2b4 T C 1: 133,656,506 (GRCm39) T715A probably benign Het
Bltp3a T C 17: 28,103,992 (GRCm39) L464P possibly damaging Het
Ccdc180 A T 4: 45,917,508 (GRCm39) H283L probably damaging Het
Cfap91 A G 16: 38,152,683 (GRCm39) S176P probably benign Het
Cfb A G 17: 35,078,002 (GRCm39) V976A probably damaging Het
Cltc T C 11: 86,595,989 (GRCm39) T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,180,730 (GRCm39) D131E probably damaging Het
Dmxl1 T C 18: 50,026,651 (GRCm39) S1920P probably damaging Het
Dnajc13 G A 9: 104,108,185 (GRCm39) H197Y probably benign Het
Dpy19l1 C T 9: 24,349,924 (GRCm39) probably null Het
Ears2 A G 7: 121,643,683 (GRCm39) probably benign Het
Epgn A C 5: 91,176,136 (GRCm39) probably benign Het
Ern1 T C 11: 106,302,601 (GRCm39) T418A probably benign Het
F12 G A 13: 55,567,981 (GRCm39) P476S probably benign Het
Gal3st2c C T 1: 93,936,930 (GRCm39) Q292* probably null Het
Galnt7 C A 8: 58,037,061 (GRCm39) Q109H possibly damaging Het
Gimap1 G T 6: 48,720,032 (GRCm39) G215W probably damaging Het
Gm28042 T A 2: 119,872,082 (GRCm39) probably null Het
Gm5414 A G 15: 101,534,252 (GRCm39) I284T possibly damaging Het
Hddc3 A G 7: 79,992,914 (GRCm39) E10G probably damaging Het
Hmgxb3 T C 18: 61,305,266 (GRCm39) K31E probably damaging Het
Hspg2 A C 4: 137,246,083 (GRCm39) Y989S probably damaging Het
Kif12 G A 4: 63,086,141 (GRCm39) T402M probably benign Het
Klhdc4 A T 8: 122,540,529 (GRCm39) L115* probably null Het
Lama2 C T 10: 27,066,699 (GRCm39) V1061M possibly damaging Het
Llgl1 C T 11: 60,602,833 (GRCm39) T836I possibly damaging Het
Map4k4 A G 1: 40,025,922 (GRCm39) D304G probably damaging Het
Matn2 A G 15: 34,433,660 (GRCm39) Q915R possibly damaging Het
Myo18a A G 11: 77,755,668 (GRCm39) probably benign Het
Myorg C A 4: 41,498,407 (GRCm39) E408* probably null Het
Nbn A T 4: 15,965,132 (GRCm39) probably null Het
Nek8 G A 11: 78,061,297 (GRCm39) Q383* probably null Het
Nme7 T G 1: 164,208,245 (GRCm39) Y304* probably null Het
Nol8 A T 13: 49,814,588 (GRCm39) H214L probably benign Het
Nostrin A T 2: 69,006,098 (GRCm39) I261F possibly damaging Het
Oprk1 T G 1: 5,672,897 (GRCm39) C345G probably damaging Het
Or13a18 A G 7: 140,190,102 (GRCm39) T8A probably benign Het
Or52j3 A T 7: 102,836,710 (GRCm39) I301L probably benign Het
Polrmt T C 10: 79,573,310 (GRCm39) S998G probably benign Het
Ppp1r12c T A 7: 4,487,495 (GRCm39) R393* probably null Het
Prpf3 T A 3: 95,757,036 (GRCm39) probably benign Het
Rabl6 T C 2: 25,475,385 (GRCm39) M563V probably benign Het
Rasa2 C A 9: 96,426,844 (GRCm39) E775* probably null Het
Rc3h1 G T 1: 160,779,222 (GRCm39) V552L probably damaging Het
Rhot1 A T 11: 80,137,592 (GRCm39) N365Y possibly damaging Het
Rimbp3 G A 16: 17,027,781 (GRCm39) V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 (GRCm39) probably null Het
Slc25a11 T C 11: 70,536,643 (GRCm39) E141G probably damaging Het
Slc34a1 A T 13: 55,548,975 (GRCm39) I142F probably damaging Het
Socs6 A C 18: 88,887,504 (GRCm39) Y470* probably null Het
Sox12 A T 2: 152,239,098 (GRCm39) L174Q unknown Het
Srl A G 16: 4,314,267 (GRCm39) probably null Het
Tacc1 A T 8: 25,691,237 (GRCm39) V22E probably damaging Het
Thsd7a A T 6: 12,379,582 (GRCm39) C947* probably null Het
Tlr12 A C 4: 128,512,169 (GRCm39) V27G probably damaging Het
Tmprss4 C A 9: 45,085,260 (GRCm39) V398L probably benign Het
Trip6 T C 5: 137,310,434 (GRCm39) D270G probably damaging Het
Uba5 T G 9: 103,926,497 (GRCm39) N355T probably benign Het
Ubr5 A G 15: 38,006,761 (GRCm39) Y1171H probably benign Het
Vmn2r57 A G 7: 41,049,664 (GRCm39) I695T probably benign Het
Vmn2r79 T A 7: 86,651,177 (GRCm39) M192K probably damaging Het
Vps16 G T 2: 130,285,288 (GRCm39) E782* probably null Het
Zfp783 A G 6: 47,923,737 (GRCm39) noncoding transcript Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 84,886,819 (GRCm39) missense probably benign
IGL01477:Vmn2r68 APN 7 84,882,691 (GRCm39) missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 84,871,468 (GRCm39) missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 84,871,325 (GRCm39) missense probably benign
IGL01999:Vmn2r68 APN 7 84,871,439 (GRCm39) missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 84,870,947 (GRCm39) missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 84,871,153 (GRCm39) nonsense probably null
IGL02827:Vmn2r68 APN 7 84,886,800 (GRCm39) missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 84,882,595 (GRCm39) missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 84,883,649 (GRCm39) missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 84,871,448 (GRCm39) nonsense probably null
IGL03166:Vmn2r68 APN 7 84,871,331 (GRCm39) missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 84,870,972 (GRCm39) missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 84,882,963 (GRCm39) missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0280:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0281:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0348:Vmn2r68 UTSW 7 84,870,884 (GRCm39) missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 84,882,466 (GRCm39) critical splice donor site probably null
R0390:Vmn2r68 UTSW 7 84,882,457 (GRCm39) splice site probably benign
R0722:Vmn2r68 UTSW 7 84,870,794 (GRCm39) missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 84,886,712 (GRCm39) splice site probably null
R1136:Vmn2r68 UTSW 7 84,871,549 (GRCm39) missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 84,881,700 (GRCm39) missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 84,870,946 (GRCm39) missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 84,882,574 (GRCm39) missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 84,882,886 (GRCm39) missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 84,883,867 (GRCm39) nonsense probably null
R1908:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 84,883,260 (GRCm39) missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 84,883,102 (GRCm39) missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 84,871,123 (GRCm39) missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2185:Vmn2r68 UTSW 7 84,882,901 (GRCm39) nonsense probably null
R2188:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R2282:Vmn2r68 UTSW 7 84,870,859 (GRCm39) missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 84,883,803 (GRCm39) missense probably benign
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 84,882,834 (GRCm39) missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 84,886,875 (GRCm39) missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R3978:Vmn2r68 UTSW 7 84,881,670 (GRCm39) missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4401:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4421:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4478:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4479:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4495:Vmn2r68 UTSW 7 84,870,758 (GRCm39) frame shift probably null
R4628:Vmn2r68 UTSW 7 84,883,673 (GRCm39) missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 84,870,743 (GRCm39) missense probably benign
R4654:Vmn2r68 UTSW 7 84,882,769 (GRCm39) nonsense probably null
R4793:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 84,881,622 (GRCm39) missense probably benign
R5021:Vmn2r68 UTSW 7 84,882,942 (GRCm39) missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 84,883,076 (GRCm39) missense probably benign 0.12
R5221:Vmn2r68 UTSW 7 84,871,085 (GRCm39) missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 84,886,767 (GRCm39) missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 84,882,926 (GRCm39) missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 84,871,283 (GRCm39) missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 84,882,978 (GRCm39) missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 84,886,812 (GRCm39) missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 84,871,453 (GRCm39) missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 84,883,048 (GRCm39) missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 84,870,973 (GRCm39) missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 84,882,915 (GRCm39) missense probably benign
R6699:Vmn2r68 UTSW 7 84,881,583 (GRCm39) missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 84,871,460 (GRCm39) missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 84,883,042 (GRCm39) missense probably benign
R7374:Vmn2r68 UTSW 7 84,881,607 (GRCm39) missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 84,881,587 (GRCm39) missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 84,883,116 (GRCm39) missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 84,883,722 (GRCm39) missense probably benign
R7979:Vmn2r68 UTSW 7 84,883,625 (GRCm39) critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 84,871,422 (GRCm39) nonsense probably null
R8349:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 84,871,108 (GRCm39) missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 84,886,722 (GRCm39) missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 84,882,785 (GRCm39) missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 84,883,648 (GRCm39) missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 84,871,321 (GRCm39) missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 84,871,420 (GRCm39) missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 84,882,993 (GRCm39) missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 84,882,757 (GRCm39) missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 84,871,088 (GRCm39) missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 84,871,289 (GRCm39) missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 84,870,941 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 84,871,307 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCAACAGAGCCCATGTATCC -3'
(R):5'- ACGCTCAGCTATGTACTACTCATC -3'

Sequencing Primer
(F):5'- GAGCCCATGTATCCAAGGAC -3'
(R):5'- ACTTTACATTGGTCATCCCACTG -3'
Posted On 2016-07-06