Incidental Mutation 'R5177:Ears2'
ID 399594
Institutional Source Beutler Lab
Gene Symbol Ears2
Ensembl Gene ENSMUSG00000030871
Gene Name glutamyl-tRNA synthetase 2, mitochondrial
Synonyms 3230401I01Rik
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5177 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 122037213-122067263 bp(-) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) A to G at 122044460 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033159]
AlphaFold Q9CXJ1
Predicted Effect probably benign
Transcript: ENSMUST00000033159
SMART Domains Protein: ENSMUSP00000033159
Gene: ENSMUSG00000030871

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 36 353 3.5e-88 PFAM
low complexity region 448 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151530
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of glutamate to tRNA molecules. Mutations in a similar gene in human have been associated with combined oxidative phosphorylation deficiency 12 (COXPD12). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Ears2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ears2 APN 7 122039762 nonsense probably null
IGL00870:Ears2 APN 7 122055676 missense probably damaging 1.00
IGL01434:Ears2 APN 7 122063088 splice site probably benign
IGL01676:Ears2 APN 7 122044558 missense probably benign
IGL02341:Ears2 APN 7 122039764 missense probably benign
IGL02355:Ears2 APN 7 122044550 missense probably benign 0.00
IGL02362:Ears2 APN 7 122044550 missense probably benign 0.00
IGL02932:Ears2 APN 7 122063061 missense probably damaging 1.00
PIT4453001:Ears2 UTSW 7 122048339 missense probably benign 0.04
R0555:Ears2 UTSW 7 122048444 missense probably benign 0.22
R0582:Ears2 UTSW 7 122055658 missense probably benign 0.05
R0588:Ears2 UTSW 7 122044291 splice site probably benign
R0733:Ears2 UTSW 7 122048129 missense possibly damaging 0.83
R1316:Ears2 UTSW 7 122046682 missense probably benign 0.00
R1916:Ears2 UTSW 7 122044578 missense probably benign 0.01
R2862:Ears2 UTSW 7 122062940 missense probably damaging 1.00
R4634:Ears2 UTSW 7 122044609 missense probably benign 0.00
R4686:Ears2 UTSW 7 122048204 missense probably damaging 1.00
R5275:Ears2 UTSW 7 122048198 missense probably damaging 1.00
R5295:Ears2 UTSW 7 122048198 missense probably damaging 1.00
R5385:Ears2 UTSW 7 122044377 missense probably benign 0.36
R5386:Ears2 UTSW 7 122044377 missense probably benign 0.36
R6510:Ears2 UTSW 7 122062994 missense probably damaging 1.00
R6894:Ears2 UTSW 7 122048224 missense probably damaging 1.00
R7828:Ears2 UTSW 7 122048340 missense probably benign
R9350:Ears2 UTSW 7 122044563 nonsense probably null
Z1176:Ears2 UTSW 7 122044581 missense probably damaging 0.98
Z1176:Ears2 UTSW 7 122055710 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGAGCACTTACCCCAGCAAG -3'
(R):5'- TTGGCGAATCAGTACCAGG -3'

Sequencing Primer
(F):5'- GCGCTTGGCAATCACATC -3'
(R):5'- GAATCAGTACCAGGGCCTCTC -3'
Posted On 2016-07-06