Incidental Mutation 'R5177:Ears2'
ID 399594
Institutional Source Beutler Lab
Gene Symbol Ears2
Ensembl Gene ENSMUSG00000030871
Gene Name glutamyl-tRNA synthetase 2, mitochondrial
Synonyms 3230401I01Rik
MMRRC Submission 042757-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5177 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 121636436-121666486 bp(-) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to G at 121643683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033159]
AlphaFold Q9CXJ1
Predicted Effect probably benign
Transcript: ENSMUST00000033159
SMART Domains Protein: ENSMUSP00000033159
Gene: ENSMUSG00000030871

DomainStartEndE-ValueType
Pfam:tRNA-synt_1c 36 353 3.5e-88 PFAM
low complexity region 448 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151530
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of glutamate to tRNA molecules. Mutations in a similar gene in human have been associated with combined oxidative phosphorylation deficiency 12 (COXPD12). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,115,639 (GRCm39) R575Q probably damaging Het
Arhgap22 T G 14: 33,088,650 (GRCm39) V377G probably benign Het
Asic4 T C 1: 75,427,483 (GRCm39) I3T probably damaging Het
Atp2b4 T C 1: 133,656,506 (GRCm39) T715A probably benign Het
Bltp3a T C 17: 28,103,992 (GRCm39) L464P possibly damaging Het
Ccdc180 A T 4: 45,917,508 (GRCm39) H283L probably damaging Het
Cfap91 A G 16: 38,152,683 (GRCm39) S176P probably benign Het
Cfb A G 17: 35,078,002 (GRCm39) V976A probably damaging Het
Cltc T C 11: 86,595,989 (GRCm39) T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,180,730 (GRCm39) D131E probably damaging Het
Dmxl1 T C 18: 50,026,651 (GRCm39) S1920P probably damaging Het
Dnajc13 G A 9: 104,108,185 (GRCm39) H197Y probably benign Het
Dpy19l1 C T 9: 24,349,924 (GRCm39) probably null Het
Epgn A C 5: 91,176,136 (GRCm39) probably benign Het
Ern1 T C 11: 106,302,601 (GRCm39) T418A probably benign Het
F12 G A 13: 55,567,981 (GRCm39) P476S probably benign Het
Gal3st2c C T 1: 93,936,930 (GRCm39) Q292* probably null Het
Galnt7 C A 8: 58,037,061 (GRCm39) Q109H possibly damaging Het
Gimap1 G T 6: 48,720,032 (GRCm39) G215W probably damaging Het
Gm28042 T A 2: 119,872,082 (GRCm39) probably null Het
Gm5414 A G 15: 101,534,252 (GRCm39) I284T possibly damaging Het
Hddc3 A G 7: 79,992,914 (GRCm39) E10G probably damaging Het
Hmgxb3 T C 18: 61,305,266 (GRCm39) K31E probably damaging Het
Hspg2 A C 4: 137,246,083 (GRCm39) Y989S probably damaging Het
Kif12 G A 4: 63,086,141 (GRCm39) T402M probably benign Het
Klhdc4 A T 8: 122,540,529 (GRCm39) L115* probably null Het
Lama2 C T 10: 27,066,699 (GRCm39) V1061M possibly damaging Het
Llgl1 C T 11: 60,602,833 (GRCm39) T836I possibly damaging Het
Map4k4 A G 1: 40,025,922 (GRCm39) D304G probably damaging Het
Matn2 A G 15: 34,433,660 (GRCm39) Q915R possibly damaging Het
Myo18a A G 11: 77,755,668 (GRCm39) probably benign Het
Myorg C A 4: 41,498,407 (GRCm39) E408* probably null Het
Nbn A T 4: 15,965,132 (GRCm39) probably null Het
Nek8 G A 11: 78,061,297 (GRCm39) Q383* probably null Het
Nme7 T G 1: 164,208,245 (GRCm39) Y304* probably null Het
Nol8 A T 13: 49,814,588 (GRCm39) H214L probably benign Het
Nostrin A T 2: 69,006,098 (GRCm39) I261F possibly damaging Het
Oprk1 T G 1: 5,672,897 (GRCm39) C345G probably damaging Het
Or13a18 A G 7: 140,190,102 (GRCm39) T8A probably benign Het
Or52j3 A T 7: 102,836,710 (GRCm39) I301L probably benign Het
Polrmt T C 10: 79,573,310 (GRCm39) S998G probably benign Het
Ppp1r12c T A 7: 4,487,495 (GRCm39) R393* probably null Het
Prpf3 T A 3: 95,757,036 (GRCm39) probably benign Het
Rabl6 T C 2: 25,475,385 (GRCm39) M563V probably benign Het
Rasa2 C A 9: 96,426,844 (GRCm39) E775* probably null Het
Rc3h1 G T 1: 160,779,222 (GRCm39) V552L probably damaging Het
Rhot1 A T 11: 80,137,592 (GRCm39) N365Y possibly damaging Het
Rimbp3 G A 16: 17,027,781 (GRCm39) V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 (GRCm39) probably null Het
Slc25a11 T C 11: 70,536,643 (GRCm39) E141G probably damaging Het
Slc34a1 A T 13: 55,548,975 (GRCm39) I142F probably damaging Het
Socs6 A C 18: 88,887,504 (GRCm39) Y470* probably null Het
Sox12 A T 2: 152,239,098 (GRCm39) L174Q unknown Het
Srl A G 16: 4,314,267 (GRCm39) probably null Het
Tacc1 A T 8: 25,691,237 (GRCm39) V22E probably damaging Het
Thsd7a A T 6: 12,379,582 (GRCm39) C947* probably null Het
Tlr12 A C 4: 128,512,169 (GRCm39) V27G probably damaging Het
Tmprss4 C A 9: 45,085,260 (GRCm39) V398L probably benign Het
Trip6 T C 5: 137,310,434 (GRCm39) D270G probably damaging Het
Uba5 T G 9: 103,926,497 (GRCm39) N355T probably benign Het
Ubr5 A G 15: 38,006,761 (GRCm39) Y1171H probably benign Het
Vmn2r57 A G 7: 41,049,664 (GRCm39) I695T probably benign Het
Vmn2r68 T A 7: 84,871,199 (GRCm39) I695L probably damaging Het
Vmn2r79 T A 7: 86,651,177 (GRCm39) M192K probably damaging Het
Vps16 G T 2: 130,285,288 (GRCm39) E782* probably null Het
Zfp783 A G 6: 47,923,737 (GRCm39) noncoding transcript Het
Other mutations in Ears2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Ears2 APN 7 121,638,985 (GRCm39) nonsense probably null
IGL00870:Ears2 APN 7 121,654,899 (GRCm39) missense probably damaging 1.00
IGL01434:Ears2 APN 7 121,662,311 (GRCm39) splice site probably benign
IGL01676:Ears2 APN 7 121,643,781 (GRCm39) missense probably benign
IGL02341:Ears2 APN 7 121,638,987 (GRCm39) missense probably benign
IGL02355:Ears2 APN 7 121,643,773 (GRCm39) missense probably benign 0.00
IGL02362:Ears2 APN 7 121,643,773 (GRCm39) missense probably benign 0.00
IGL02932:Ears2 APN 7 121,662,284 (GRCm39) missense probably damaging 1.00
PIT4453001:Ears2 UTSW 7 121,647,562 (GRCm39) missense probably benign 0.04
R0555:Ears2 UTSW 7 121,647,667 (GRCm39) missense probably benign 0.22
R0582:Ears2 UTSW 7 121,654,881 (GRCm39) missense probably benign 0.05
R0588:Ears2 UTSW 7 121,643,514 (GRCm39) splice site probably benign
R0733:Ears2 UTSW 7 121,647,352 (GRCm39) missense possibly damaging 0.83
R1316:Ears2 UTSW 7 121,645,905 (GRCm39) missense probably benign 0.00
R1916:Ears2 UTSW 7 121,643,801 (GRCm39) missense probably benign 0.01
R2862:Ears2 UTSW 7 121,662,163 (GRCm39) missense probably damaging 1.00
R4634:Ears2 UTSW 7 121,643,832 (GRCm39) missense probably benign 0.00
R4686:Ears2 UTSW 7 121,647,427 (GRCm39) missense probably damaging 1.00
R5275:Ears2 UTSW 7 121,647,421 (GRCm39) missense probably damaging 1.00
R5295:Ears2 UTSW 7 121,647,421 (GRCm39) missense probably damaging 1.00
R5385:Ears2 UTSW 7 121,643,600 (GRCm39) missense probably benign 0.36
R5386:Ears2 UTSW 7 121,643,600 (GRCm39) missense probably benign 0.36
R6510:Ears2 UTSW 7 121,662,217 (GRCm39) missense probably damaging 1.00
R6894:Ears2 UTSW 7 121,647,447 (GRCm39) missense probably damaging 1.00
R7828:Ears2 UTSW 7 121,647,563 (GRCm39) missense probably benign
R9350:Ears2 UTSW 7 121,643,786 (GRCm39) nonsense probably null
Z1176:Ears2 UTSW 7 121,654,933 (GRCm39) missense possibly damaging 0.81
Z1176:Ears2 UTSW 7 121,643,804 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCACTTACCCCAGCAAG -3'
(R):5'- TTGGCGAATCAGTACCAGG -3'

Sequencing Primer
(F):5'- GCGCTTGGCAATCACATC -3'
(R):5'- GAATCAGTACCAGGGCCTCTC -3'
Posted On 2016-07-06