Incidental Mutation 'R5256:Vmn2r6'
ID399597
Institutional Source Beutler Lab
Gene Symbol Vmn2r6
Ensembl Gene ENSMUSG00000090581
Gene Namevomeronasal 2, receptor 6
SynonymsEG620718, EG667069
MMRRC Submission 042827-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R5256 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64537561-64565298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64556842 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 190 (N190K)
Ref Sequence ENSEMBL: ENSMUSP00000135148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165012] [ENSMUST00000176481]
Predicted Effect probably benign
Transcript: ENSMUST00000165012
AA Change: N101K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000131831
Gene: ENSMUSG00000090581
AA Change: N101K

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 1.4e-72 PFAM
Pfam:Peripla_BP_6 58 244 1.2e-10 PFAM
Pfam:NCD3G 458 511 1.8e-17 PFAM
Pfam:7tm_3 542 779 3.9e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176481
AA Change: N190K

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135148
Gene: ENSMUSG00000090581
AA Change: N190K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 9.8e-77 PFAM
Pfam:Peripla_BP_6 142 331 3.4e-10 PFAM
Pfam:NCD3G 547 600 5.4e-17 PFAM
Pfam:7tm_3 633 867 3.9e-47 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730015C16Rik C A 4: 108,848,065 probably benign Het
Actr1b T C 1: 36,700,092 H372R probably benign Het
Ampd2 C A 3: 108,079,549 probably benign Het
Anapc4 A G 5: 52,863,594 S612G probably benign Het
Arhgef7 T C 8: 11,800,811 L141P probably damaging Het
Atl1 A G 12: 69,959,333 D471G probably damaging Het
Atrn A G 2: 130,946,019 D247G probably benign Het
Bag1 T A 4: 40,948,022 R61W probably damaging Het
Card10 C T 15: 78,778,251 R898H probably damaging Het
Cct6b G A 11: 82,764,220 A3V probably damaging Het
Cfap54 A T 10: 92,935,091 L2097* probably null Het
Cfap54 T C 10: 93,045,023 probably null Het
Chd5 T C 4: 152,372,097 F964L probably benign Het
Cog5 A G 12: 31,886,205 T584A probably benign Het
Cpa2 T A 6: 30,547,197 N157K probably damaging Het
Cpeb1 A T 7: 81,351,839 M440K probably damaging Het
Cracr2a G A 6: 127,604,029 C56Y probably damaging Het
Ddb2 A C 2: 91,236,728 L30R probably damaging Het
Dlk1 T A 12: 109,459,771 I190N probably damaging Het
Dnajc13 T A 9: 104,203,329 Y851F possibly damaging Het
Dopey1 T A 9: 86,515,328 L895Q probably damaging Het
Dyx1c1 T C 9: 72,972,080 probably null Het
F7 G A 8: 13,030,763 C122Y probably damaging Het
Frrs1 T C 3: 116,903,100 V573A possibly damaging Het
Gm17541 A T 12: 4,689,672 probably benign Het
Gm20388 T C 8: 122,270,436 probably benign Het
Gm5519 A T 19: 33,823,176 H90L probably damaging Het
Gm5526 T A 1: 45,857,409 noncoding transcript Het
Gm5709 A T 3: 59,602,550 noncoding transcript Het
Golga4 T A 9: 118,556,501 V869D possibly damaging Het
Grm7 A T 6: 111,358,221 Q531L probably benign Het
Hnrnpu C A 1: 178,335,893 C265F unknown Het
Hoxd3 G A 2: 74,746,867 V364I possibly damaging Het
Hspb8 T C 5: 116,409,473 D150G probably damaging Het
Hydin C A 8: 110,587,223 N4244K possibly damaging Het
Ik A G 18: 36,748,873 D136G probably benign Het
Il11ra1 T C 4: 41,767,932 probably benign Het
Jph1 T C 1: 17,091,398 I347V probably benign Het
Klk1 T A 7: 44,221,561 probably benign Het
Lmcd1 T A 6: 112,288,126 probably benign Het
Lnx1 C T 5: 74,685,654 C45Y probably damaging Het
Macc1 T A 12: 119,446,529 M344K possibly damaging Het
Madcam1 A G 10: 79,664,945 E32G possibly damaging Het
Mat2a T C 6: 72,434,333 D383G probably benign Het
Mpst T A 15: 78,413,649 I289N probably damaging Het
Myh6 C T 14: 54,952,661 R1055Q probably damaging Het
Myh7 T C 14: 54,979,508 K1131E probably damaging Het
Ndrg3 A T 2: 156,931,205 probably benign Het
Nebl A G 2: 17,433,975 S209P probably benign Het
Nid2 A G 14: 19,768,208 probably null Het
Nup188 A T 2: 30,330,749 S945C probably damaging Het
Olfr1000 C T 2: 85,608,473 V146I probably benign Het
Olfr251 A G 9: 38,377,917 N12S probably benign Het
Olfr50 A G 2: 36,793,673 M146V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Patl2 A G 2: 122,128,887 L32P probably damaging Het
Pcdh20 T A 14: 88,468,377 M496L probably benign Het
Pdzd2 A G 15: 12,372,942 V2369A possibly damaging Het
Pfn2 A G 3: 57,847,391 V31A probably damaging Het
Plxna4 T C 6: 32,251,072 N533S probably benign Het
Plxnb1 T C 9: 109,114,593 F1916S probably damaging Het
Ppp4r3b T C 11: 29,188,293 F214L probably benign Het
Prox1 T C 1: 190,161,441 D269G probably benign Het
Rapgef4 T C 2: 72,034,034 F71S probably damaging Het
Rft1 A G 14: 30,661,286 I94M probably benign Het
S100z T C 13: 95,478,619 I13V probably damaging Het
Serhl T A 15: 83,102,634 V117E probably damaging Het
Shroom1 G A 11: 53,465,507 R336Q probably benign Het
Sik3 A T 9: 46,212,254 Q1067L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc28a1 G A 7: 81,122,121 V118M probably damaging Het
Slco1a6 T A 6: 142,132,701 I153F probably benign Het
Ss18l1 T C 2: 180,061,942 Y323H unknown Het
Susd4 G T 1: 182,892,259 A480S possibly damaging Het
Syne3 A T 12: 104,975,880 M1K probably null Het
Synpo2l A T 14: 20,661,014 S513T probably benign Het
Tat A T 8: 109,998,334 N388I probably benign Het
Tbc1d1 A G 5: 64,282,009 Y619C probably damaging Het
Tbk1 G A 10: 121,570,685 T216M probably damaging Het
Tns1 C T 1: 73,995,426 probably benign Het
Trbv5 T C 6: 41,062,384 V9A possibly damaging Het
Trpm5 A G 7: 143,082,303 Y575H probably damaging Het
Ttn A T 2: 76,739,701 Y25203* probably null Het
Tubb3 C A 8: 123,421,652 D441E probably benign Het
Usp33 T A 3: 152,391,696 C850* probably null Het
Vdac1 G A 11: 52,384,078 probably null Het
Vmn1r232 T C 17: 20,913,584 I251M probably damaging Het
Vmn2r11 T G 5: 109,054,792 I140L probably benign Het
Vps51 T A 19: 6,070,488 H465L probably benign Het
Zfp318 T G 17: 46,412,069 I1666S probably benign Het
Zfp446 C T 7: 12,979,304 R90* probably null Het
Zgrf1 T A 3: 127,602,445 F547I probably damaging Het
Other mutations in Vmn2r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Vmn2r6 APN 3 64538104 missense probably damaging 1.00
IGL01968:Vmn2r6 APN 3 64556345 missense possibly damaging 0.94
IGL02009:Vmn2r6 APN 3 64537902 missense possibly damaging 0.61
IGL02039:Vmn2r6 APN 3 64556189 missense probably damaging 1.00
IGL02652:Vmn2r6 APN 3 64556328 missense probably benign 0.24
IGL02737:Vmn2r6 APN 3 64556490 missense possibly damaging 0.55
IGL02808:Vmn2r6 APN 3 64556496 missense probably damaging 1.00
IGL03066:Vmn2r6 APN 3 64565153 missense probably damaging 0.99
IGL03331:Vmn2r6 APN 3 64538007 missense probably damaging 1.00
BB010:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
BB020:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R0010:Vmn2r6 UTSW 3 64559545 nonsense probably null
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0206:Vmn2r6 UTSW 3 64539912 missense probably benign
R0208:Vmn2r6 UTSW 3 64539912 missense probably benign
R0427:Vmn2r6 UTSW 3 64559587 missense probably damaging 1.00
R0466:Vmn2r6 UTSW 3 64556302 missense probably damaging 1.00
R1018:Vmn2r6 UTSW 3 64556840 missense probably benign 0.00
R1104:Vmn2r6 UTSW 3 64538066 missense possibly damaging 0.93
R1186:Vmn2r6 UTSW 3 64565067 missense probably benign 0.01
R1245:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R1295:Vmn2r6 UTSW 3 64538273 missense probably damaging 1.00
R1473:Vmn2r6 UTSW 3 64538158 nonsense probably null
R1498:Vmn2r6 UTSW 3 64556469 missense probably damaging 1.00
R1925:Vmn2r6 UTSW 3 64556277 missense possibly damaging 0.87
R2044:Vmn2r6 UTSW 3 64537841 missense probably damaging 0.96
R2069:Vmn2r6 UTSW 3 64556098 missense possibly damaging 0.89
R2253:Vmn2r6 UTSW 3 64559718 missense probably damaging 1.00
R2261:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2262:Vmn2r6 UTSW 3 64556669 missense probably benign 0.24
R2350:Vmn2r6 UTSW 3 64556352 missense probably benign 0.01
R2680:Vmn2r6 UTSW 3 64538286 missense possibly damaging 0.91
R2846:Vmn2r6 UTSW 3 64556790 missense possibly damaging 0.53
R2860:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R2861:Vmn2r6 UTSW 3 64547339 missense probably benign 0.00
R3766:Vmn2r6 UTSW 3 64556508 missense probably benign 0.19
R3870:Vmn2r6 UTSW 3 64556621 missense probably damaging 0.96
R4018:Vmn2r6 UTSW 3 64556472 missense probably benign 0.05
R4024:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4026:Vmn2r6 UTSW 3 64538250 missense possibly damaging 0.73
R4227:Vmn2r6 UTSW 3 64537948 missense probably damaging 0.99
R4526:Vmn2r6 UTSW 3 64537724 missense probably benign 0.32
R4570:Vmn2r6 UTSW 3 64559647 missense probably benign 0.31
R4894:Vmn2r6 UTSW 3 64547408 missense probably benign
R4934:Vmn2r6 UTSW 3 64556345 missense probably damaging 0.99
R5057:Vmn2r6 UTSW 3 64537786 missense probably damaging 1.00
R5059:Vmn2r6 UTSW 3 64537623 missense possibly damaging 0.89
R5148:Vmn2r6 UTSW 3 64556594 missense probably damaging 0.99
R5155:Vmn2r6 UTSW 3 64538514 missense probably benign 0.44
R5179:Vmn2r6 UTSW 3 64537990 missense probably benign 0.00
R5861:Vmn2r6 UTSW 3 64556033 missense probably benign 0.00
R5950:Vmn2r6 UTSW 3 64565231 missense probably benign 0.05
R6081:Vmn2r6 UTSW 3 64556532 missense probably benign 0.25
R6173:Vmn2r6 UTSW 3 64559755 missense probably damaging 1.00
R6190:Vmn2r6 UTSW 3 64538003 missense probably benign 0.04
R6240:Vmn2r6 UTSW 3 64556805 missense probably damaging 1.00
R6433:Vmn2r6 UTSW 3 64547380 nonsense probably null
R6645:Vmn2r6 UTSW 3 64556876 missense probably damaging 1.00
R6791:Vmn2r6 UTSW 3 64538159 missense probably damaging 1.00
R7265:Vmn2r6 UTSW 3 64556774 missense probably benign 0.00
R7503:Vmn2r6 UTSW 3 64539951 nonsense probably null
R7562:Vmn2r6 UTSW 3 64556520 missense probably benign 0.00
R7584:Vmn2r6 UTSW 3 64565262 missense probably benign 0.07
R7611:Vmn2r6 UTSW 3 64565142 missense probably damaging 0.98
R7759:Vmn2r6 UTSW 3 64556570 missense probably damaging 1.00
R7834:Vmn2r6 UTSW 3 64538022 missense probably damaging 1.00
R7933:Vmn2r6 UTSW 3 64559803 missense probably benign 0.02
R8024:Vmn2r6 UTSW 3 64559824 missense probably benign 0.40
R8074:Vmn2r6 UTSW 3 64547643 intron probably benign
R8169:Vmn2r6 UTSW 3 64539889 missense probably benign 0.01
X0020:Vmn2r6 UTSW 3 64538450 missense probably benign
X0066:Vmn2r6 UTSW 3 64547378 missense probably damaging 1.00
Z1176:Vmn2r6 UTSW 3 64556325 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACAAAGGTTGGCCCTCTC -3'
(R):5'- GAGTTGTCAAAATTGTCCCCATCTAC -3'

Sequencing Primer
(F):5'- AAAGGTTGGCCCTCTCCATTTC -3'
(R):5'- AGATTAAACAGGAAGTCACTGTCTAC -3'
Posted On2016-07-06