Incidental Mutation 'R5177:Galnt7'
ID399600
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Namepolypeptide N-acetylgalactosaminyltransferase 7
SynonymsppGaNTase-T7
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location57523828-57653032 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57584027 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 109 (Q109H)
Ref Sequence ENSEMBL: ENSMUSP00000105945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034021
AA Change: Q109H

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: Q109H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110316
AA Change: Q109H

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: Q109H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156907
Meta Mutation Damage Score 0.5074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57540039 missense probably damaging 1.00
IGL00538:Galnt7 APN 8 57552522 missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57540071 nonsense probably null
IGL00951:Galnt7 APN 8 57583824 missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57531735 splice site probably benign
IGL02280:Galnt7 APN 8 57536790 missense probably damaging 1.00
IGL02832:Galnt7 APN 8 57552497 missense probably damaging 1.00
IGL02936:Galnt7 APN 8 57584214 missense probably benign
IGL03083:Galnt7 APN 8 57526189 missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57526178 missense probably benign 0.01
R0400:Galnt7 UTSW 8 57583989 missense probably damaging 0.99
R0553:Galnt7 UTSW 8 57552430 splice site probably benign
R1463:Galnt7 UTSW 8 57652858 missense probably benign
R1487:Galnt7 UTSW 8 57540039 missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57542530 missense probably benign 0.05
R1817:Galnt7 UTSW 8 57538178 missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57532714 missense probably benign 0.13
R3855:Galnt7 UTSW 8 57532624 splice site probably benign
R3856:Galnt7 UTSW 8 57532624 splice site probably benign
R4232:Galnt7 UTSW 8 57652966 missense probably benign
R4396:Galnt7 UTSW 8 57538181 missense probably damaging 1.00
R4426:Galnt7 UTSW 8 57552572 nonsense probably null
R4610:Galnt7 UTSW 8 57545769 missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57542727 intron probably benign
R4794:Galnt7 UTSW 8 57545363 missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57545380 missense probably damaging 1.00
R5682:Galnt7 UTSW 8 57583933 nonsense probably null
R6122:Galnt7 UTSW 8 57526166 missense probably damaging 0.99
R6276:Galnt7 UTSW 8 57536578 splice site probably null
R6684:Galnt7 UTSW 8 57538109 missense probably benign 0.16
R6752:Galnt7 UTSW 8 57652951 missense probably damaging 1.00
R7464:Galnt7 UTSW 8 57584020 missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 57552518 missense probably damaging 0.97
R7547:Galnt7 UTSW 8 57583962 missense possibly damaging 0.48
X0050:Galnt7 UTSW 8 57552444 frame shift probably null
X0062:Galnt7 UTSW 8 57583908 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTCACTTGCCACCATGTTAAATCC -3'
(R):5'- TAACCCCTTGCCTAACCGAG -3'

Sequencing Primer
(F):5'- CAAACTCCTTAATGCTGGCTTGAAC -3'
(R):5'- GGAGGCAATGGACTAGCTCCTG -3'
Posted On2016-07-06