Incidental Mutation 'R5177:Galnt7'
ID 399600
Institutional Source Beutler Lab
Gene Symbol Galnt7
Ensembl Gene ENSMUSG00000031608
Gene Name polypeptide N-acetylgalactosaminyltransferase 7
Synonyms ppGaNTase-T7
MMRRC Submission 042757-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.830) question?
Stock # R5177 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 57976862-58106066 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 58037061 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 109 (Q109H)
Ref Sequence ENSEMBL: ENSMUSP00000105945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034021] [ENSMUST00000110316]
AlphaFold Q80VA0
Predicted Effect possibly damaging
Transcript: ENSMUST00000034021
AA Change: Q109H

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034021
Gene: ENSMUSG00000031608
AA Change: Q109H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 3e-28 PFAM
Pfam:Glyco_tranf_2_2 210 490 2e-7 PFAM
Pfam:Glyco_transf_7C 375 445 1.8e-8 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110316
AA Change: Q109H

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105945
Gene: ENSMUSG00000031608
AA Change: Q109H

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
Pfam:Glycos_transf_2 210 399 8.2e-27 PFAM
Pfam:Glyco_tranf_2_2 210 490 1.3e-7 PFAM
Pfam:Glyco_transf_7C 369 445 9.3e-9 PFAM
RICIN 531 652 3.39e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156907
Meta Mutation Damage Score 0.5074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes GalNAc transferase 7, a member of the GalNAc-transferase family. The enzyme encoded by this gene controls the initiation step of mucin-type O-linked protein glycosylation and transfer of N-acetylgalactosamine to serine and threonine amino acid residues. This enzyme is a type II transmembrane protein and shares common sequence motifs with other family members. Unlike other family members, this enzyme shows exclusive specificity for partially GalNAc-glycosylated acceptor substrates and shows no activity with non-glycosylated peptides. This protein may function as a follow-up enzyme in the initiation step of O-glycosylation. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,115,639 (GRCm39) R575Q probably damaging Het
Arhgap22 T G 14: 33,088,650 (GRCm39) V377G probably benign Het
Asic4 T C 1: 75,427,483 (GRCm39) I3T probably damaging Het
Atp2b4 T C 1: 133,656,506 (GRCm39) T715A probably benign Het
Bltp3a T C 17: 28,103,992 (GRCm39) L464P possibly damaging Het
Ccdc180 A T 4: 45,917,508 (GRCm39) H283L probably damaging Het
Cfap91 A G 16: 38,152,683 (GRCm39) S176P probably benign Het
Cfb A G 17: 35,078,002 (GRCm39) V976A probably damaging Het
Cltc T C 11: 86,595,989 (GRCm39) T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,180,730 (GRCm39) D131E probably damaging Het
Dmxl1 T C 18: 50,026,651 (GRCm39) S1920P probably damaging Het
Dnajc13 G A 9: 104,108,185 (GRCm39) H197Y probably benign Het
Dpy19l1 C T 9: 24,349,924 (GRCm39) probably null Het
Ears2 A G 7: 121,643,683 (GRCm39) probably benign Het
Epgn A C 5: 91,176,136 (GRCm39) probably benign Het
Ern1 T C 11: 106,302,601 (GRCm39) T418A probably benign Het
F12 G A 13: 55,567,981 (GRCm39) P476S probably benign Het
Gal3st2c C T 1: 93,936,930 (GRCm39) Q292* probably null Het
Gimap1 G T 6: 48,720,032 (GRCm39) G215W probably damaging Het
Gm28042 T A 2: 119,872,082 (GRCm39) probably null Het
Gm5414 A G 15: 101,534,252 (GRCm39) I284T possibly damaging Het
Hddc3 A G 7: 79,992,914 (GRCm39) E10G probably damaging Het
Hmgxb3 T C 18: 61,305,266 (GRCm39) K31E probably damaging Het
Hspg2 A C 4: 137,246,083 (GRCm39) Y989S probably damaging Het
Kif12 G A 4: 63,086,141 (GRCm39) T402M probably benign Het
Klhdc4 A T 8: 122,540,529 (GRCm39) L115* probably null Het
Lama2 C T 10: 27,066,699 (GRCm39) V1061M possibly damaging Het
Llgl1 C T 11: 60,602,833 (GRCm39) T836I possibly damaging Het
Map4k4 A G 1: 40,025,922 (GRCm39) D304G probably damaging Het
Matn2 A G 15: 34,433,660 (GRCm39) Q915R possibly damaging Het
Myo18a A G 11: 77,755,668 (GRCm39) probably benign Het
Myorg C A 4: 41,498,407 (GRCm39) E408* probably null Het
Nbn A T 4: 15,965,132 (GRCm39) probably null Het
Nek8 G A 11: 78,061,297 (GRCm39) Q383* probably null Het
Nme7 T G 1: 164,208,245 (GRCm39) Y304* probably null Het
Nol8 A T 13: 49,814,588 (GRCm39) H214L probably benign Het
Nostrin A T 2: 69,006,098 (GRCm39) I261F possibly damaging Het
Oprk1 T G 1: 5,672,897 (GRCm39) C345G probably damaging Het
Or13a18 A G 7: 140,190,102 (GRCm39) T8A probably benign Het
Or52j3 A T 7: 102,836,710 (GRCm39) I301L probably benign Het
Polrmt T C 10: 79,573,310 (GRCm39) S998G probably benign Het
Ppp1r12c T A 7: 4,487,495 (GRCm39) R393* probably null Het
Prpf3 T A 3: 95,757,036 (GRCm39) probably benign Het
Rabl6 T C 2: 25,475,385 (GRCm39) M563V probably benign Het
Rasa2 C A 9: 96,426,844 (GRCm39) E775* probably null Het
Rc3h1 G T 1: 160,779,222 (GRCm39) V552L probably damaging Het
Rhot1 A T 11: 80,137,592 (GRCm39) N365Y possibly damaging Het
Rimbp3 G A 16: 17,027,781 (GRCm39) V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 (GRCm39) probably null Het
Slc25a11 T C 11: 70,536,643 (GRCm39) E141G probably damaging Het
Slc34a1 A T 13: 55,548,975 (GRCm39) I142F probably damaging Het
Socs6 A C 18: 88,887,504 (GRCm39) Y470* probably null Het
Sox12 A T 2: 152,239,098 (GRCm39) L174Q unknown Het
Srl A G 16: 4,314,267 (GRCm39) probably null Het
Tacc1 A T 8: 25,691,237 (GRCm39) V22E probably damaging Het
Thsd7a A T 6: 12,379,582 (GRCm39) C947* probably null Het
Tlr12 A C 4: 128,512,169 (GRCm39) V27G probably damaging Het
Tmprss4 C A 9: 45,085,260 (GRCm39) V398L probably benign Het
Trip6 T C 5: 137,310,434 (GRCm39) D270G probably damaging Het
Uba5 T G 9: 103,926,497 (GRCm39) N355T probably benign Het
Ubr5 A G 15: 38,006,761 (GRCm39) Y1171H probably benign Het
Vmn2r57 A G 7: 41,049,664 (GRCm39) I695T probably benign Het
Vmn2r68 T A 7: 84,871,199 (GRCm39) I695L probably damaging Het
Vmn2r79 T A 7: 86,651,177 (GRCm39) M192K probably damaging Het
Vps16 G T 2: 130,285,288 (GRCm39) E782* probably null Het
Zfp783 A G 6: 47,923,737 (GRCm39) noncoding transcript Het
Other mutations in Galnt7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Galnt7 APN 8 57,993,073 (GRCm39) missense probably damaging 1.00
IGL00538:Galnt7 APN 8 58,005,556 (GRCm39) missense possibly damaging 0.95
IGL00826:Galnt7 APN 8 57,993,105 (GRCm39) nonsense probably null
IGL00951:Galnt7 APN 8 58,036,858 (GRCm39) missense probably damaging 0.96
IGL01662:Galnt7 APN 8 57,984,769 (GRCm39) splice site probably benign
IGL02280:Galnt7 APN 8 57,989,824 (GRCm39) missense probably damaging 1.00
IGL02832:Galnt7 APN 8 58,005,531 (GRCm39) missense probably damaging 1.00
IGL02936:Galnt7 APN 8 58,037,248 (GRCm39) missense probably benign
IGL03083:Galnt7 APN 8 57,979,223 (GRCm39) missense probably damaging 0.98
IGL03387:Galnt7 APN 8 57,979,212 (GRCm39) missense probably benign 0.01
R0400:Galnt7 UTSW 8 58,037,023 (GRCm39) missense probably damaging 0.99
R0553:Galnt7 UTSW 8 58,005,464 (GRCm39) splice site probably benign
R1463:Galnt7 UTSW 8 58,105,892 (GRCm39) missense probably benign
R1487:Galnt7 UTSW 8 57,993,073 (GRCm39) missense probably damaging 1.00
R1791:Galnt7 UTSW 8 57,995,564 (GRCm39) missense probably benign 0.05
R1817:Galnt7 UTSW 8 57,991,212 (GRCm39) missense probably damaging 1.00
R1962:Galnt7 UTSW 8 57,985,748 (GRCm39) missense probably benign 0.13
R3855:Galnt7 UTSW 8 57,985,658 (GRCm39) splice site probably benign
R3856:Galnt7 UTSW 8 57,985,658 (GRCm39) splice site probably benign
R4232:Galnt7 UTSW 8 58,106,000 (GRCm39) missense probably benign
R4396:Galnt7 UTSW 8 57,991,215 (GRCm39) missense probably damaging 1.00
R4426:Galnt7 UTSW 8 58,005,606 (GRCm39) nonsense probably null
R4610:Galnt7 UTSW 8 57,998,803 (GRCm39) missense probably damaging 0.99
R4745:Galnt7 UTSW 8 57,995,761 (GRCm39) intron probably benign
R4794:Galnt7 UTSW 8 57,998,397 (GRCm39) missense probably damaging 1.00
R5014:Galnt7 UTSW 8 57,998,414 (GRCm39) missense probably damaging 1.00
R5682:Galnt7 UTSW 8 58,036,967 (GRCm39) nonsense probably null
R6122:Galnt7 UTSW 8 57,979,200 (GRCm39) missense probably damaging 0.99
R6276:Galnt7 UTSW 8 57,989,612 (GRCm39) splice site probably null
R6684:Galnt7 UTSW 8 57,991,143 (GRCm39) missense probably benign 0.16
R6752:Galnt7 UTSW 8 58,105,985 (GRCm39) missense probably damaging 1.00
R7464:Galnt7 UTSW 8 58,037,054 (GRCm39) missense possibly damaging 0.95
R7491:Galnt7 UTSW 8 58,005,552 (GRCm39) missense probably damaging 0.97
R7547:Galnt7 UTSW 8 58,036,996 (GRCm39) missense possibly damaging 0.48
R8093:Galnt7 UTSW 8 57,985,739 (GRCm39) missense probably benign 0.00
R8221:Galnt7 UTSW 8 58,005,600 (GRCm39) missense possibly damaging 0.93
R8248:Galnt7 UTSW 8 57,991,222 (GRCm39) missense probably benign 0.34
R8402:Galnt7 UTSW 8 57,995,953 (GRCm39) missense probably damaging 0.98
R8779:Galnt7 UTSW 8 58,037,245 (GRCm39) missense probably benign
R8894:Galnt7 UTSW 8 57,979,176 (GRCm39) nonsense probably null
R8974:Galnt7 UTSW 8 58,105,934 (GRCm39) missense
R9106:Galnt7 UTSW 8 57,985,729 (GRCm39) missense probably damaging 1.00
R9297:Galnt7 UTSW 8 57,995,555 (GRCm39) missense probably damaging 0.98
X0050:Galnt7 UTSW 8 58,005,478 (GRCm39) frame shift probably null
X0062:Galnt7 UTSW 8 58,036,942 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GTCACTTGCCACCATGTTAAATCC -3'
(R):5'- TAACCCCTTGCCTAACCGAG -3'

Sequencing Primer
(F):5'- CAAACTCCTTAATGCTGGCTTGAAC -3'
(R):5'- GGAGGCAATGGACTAGCTCCTG -3'
Posted On 2016-07-06