Incidental Mutation 'R5256:Zgrf1'
ID399605
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission 042827-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R5256 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127602445 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 547 (F547I)
Ref Sequence ENSEMBL: ENSMUSP00000143570 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000196141] [ENSMUST00000196341] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043108
AA Change: F1431I

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: F1431I

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196141
AA Change: F1431I

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: F1431I

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196341
AA Change: F547I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143570
Gene: ENSMUSG00000051278
AA Change: F547I

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:zf-GRF 225 269 6.7e-15 PFAM
low complexity region 432 444 N/A INTRINSIC
Pfam:AAA_11 491 659 7.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197108
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Meta Mutation Damage Score 0.224 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (95/98)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730015C16Rik C A 4: 108,848,065 probably benign Het
Actr1b T C 1: 36,700,092 H372R probably benign Het
Ampd2 C A 3: 108,079,549 probably benign Het
Anapc4 A G 5: 52,863,594 S612G probably benign Het
Arhgef7 T C 8: 11,800,811 L141P probably damaging Het
Atl1 A G 12: 69,959,333 D471G probably damaging Het
Atrn A G 2: 130,946,019 D247G probably benign Het
Bag1 T A 4: 40,948,022 R61W probably damaging Het
Card10 C T 15: 78,778,251 R898H probably damaging Het
Cct6b G A 11: 82,764,220 A3V probably damaging Het
Cfap54 A T 10: 92,935,091 L2097* probably null Het
Cfap54 T C 10: 93,045,023 probably null Het
Chd5 T C 4: 152,372,097 F964L probably benign Het
Cog5 A G 12: 31,886,205 T584A probably benign Het
Cpa2 T A 6: 30,547,197 N157K probably damaging Het
Cpeb1 A T 7: 81,351,839 M440K probably damaging Het
Cracr2a G A 6: 127,604,029 C56Y probably damaging Het
Ddb2 A C 2: 91,236,728 L30R probably damaging Het
Dlk1 T A 12: 109,459,771 I190N probably damaging Het
Dnajc13 T A 9: 104,203,329 Y851F possibly damaging Het
Dopey1 T A 9: 86,515,328 L895Q probably damaging Het
Dyx1c1 T C 9: 72,972,080 probably null Het
F7 G A 8: 13,030,763 C122Y probably damaging Het
Frrs1 T C 3: 116,903,100 V573A possibly damaging Het
Gm17541 A T 12: 4,689,672 probably benign Het
Gm20388 T C 8: 122,270,436 probably benign Het
Gm5519 A T 19: 33,823,176 H90L probably damaging Het
Gm5526 T A 1: 45,857,409 noncoding transcript Het
Gm5709 A T 3: 59,602,550 noncoding transcript Het
Golga4 T A 9: 118,556,501 V869D possibly damaging Het
Grm7 A T 6: 111,358,221 Q531L probably benign Het
Hnrnpu C A 1: 178,335,893 C265F unknown Het
Hoxd3 G A 2: 74,746,867 V364I possibly damaging Het
Hspb8 T C 5: 116,409,473 D150G probably damaging Het
Hydin C A 8: 110,587,223 N4244K possibly damaging Het
Ik A G 18: 36,748,873 D136G probably benign Het
Il11ra1 T C 4: 41,767,932 probably benign Het
Jph1 T C 1: 17,091,398 I347V probably benign Het
Klk1 T A 7: 44,221,561 probably benign Het
Lmcd1 T A 6: 112,288,126 probably benign Het
Lnx1 C T 5: 74,685,654 C45Y probably damaging Het
Macc1 T A 12: 119,446,529 M344K possibly damaging Het
Madcam1 A G 10: 79,664,945 E32G possibly damaging Het
Mat2a T C 6: 72,434,333 D383G probably benign Het
Mpst T A 15: 78,413,649 I289N probably damaging Het
Myh6 C T 14: 54,952,661 R1055Q probably damaging Het
Myh7 T C 14: 54,979,508 K1131E probably damaging Het
Ndrg3 A T 2: 156,931,205 probably benign Het
Nebl A G 2: 17,433,975 S209P probably benign Het
Nid2 A G 14: 19,768,208 probably null Het
Nup188 A T 2: 30,330,749 S945C probably damaging Het
Olfr1000 C T 2: 85,608,473 V146I probably benign Het
Olfr251 A G 9: 38,377,917 N12S probably benign Het
Olfr50 A G 2: 36,793,673 M146V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Patl2 A G 2: 122,128,887 L32P probably damaging Het
Pcdh20 T A 14: 88,468,377 M496L probably benign Het
Pdzd2 A G 15: 12,372,942 V2369A possibly damaging Het
Pfn2 A G 3: 57,847,391 V31A probably damaging Het
Plxna4 T C 6: 32,251,072 N533S probably benign Het
Plxnb1 T C 9: 109,114,593 F1916S probably damaging Het
Ppp4r3b T C 11: 29,188,293 F214L probably benign Het
Prox1 T C 1: 190,161,441 D269G probably benign Het
Rapgef4 T C 2: 72,034,034 F71S probably damaging Het
Rft1 A G 14: 30,661,286 I94M probably benign Het
S100z T C 13: 95,478,619 I13V probably damaging Het
Serhl T A 15: 83,102,634 V117E probably damaging Het
Shroom1 G A 11: 53,465,507 R336Q probably benign Het
Sik3 A T 9: 46,212,254 Q1067L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc28a1 G A 7: 81,122,121 V118M probably damaging Het
Slco1a6 T A 6: 142,132,701 I153F probably benign Het
Ss18l1 T C 2: 180,061,942 Y323H unknown Het
Susd4 G T 1: 182,892,259 A480S possibly damaging Het
Syne3 A T 12: 104,975,880 M1K probably null Het
Synpo2l A T 14: 20,661,014 S513T probably benign Het
Tat A T 8: 109,998,334 N388I probably benign Het
Tbc1d1 A G 5: 64,282,009 Y619C probably damaging Het
Tbk1 G A 10: 121,570,685 T216M probably damaging Het
Tns1 C T 1: 73,995,426 probably benign Het
Trbv5 T C 6: 41,062,384 V9A possibly damaging Het
Trpm5 A G 7: 143,082,303 Y575H probably damaging Het
Ttn A T 2: 76,739,701 Y25203* probably null Het
Tubb3 C A 8: 123,421,652 D441E probably benign Het
Usp33 T A 3: 152,391,696 C850* probably null Het
Vdac1 G A 11: 52,384,078 probably null Het
Vmn1r232 T C 17: 20,913,584 I251M probably damaging Het
Vmn2r11 T G 5: 109,054,792 I140L probably benign Het
Vmn2r6 A T 3: 64,556,842 N190K probably benign Het
Vps51 T A 19: 6,070,488 H465L probably benign Het
Zfp318 T G 17: 46,412,069 I1666S probably benign Het
Zfp446 C T 7: 12,979,304 R90* probably null Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3236:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TACCTATGATTTAGCCTGTTGACTG -3'
(R):5'- TTGCACTCTTGTCAGGCAG -3'

Sequencing Primer
(F):5'- AGCCTGTTGACTGTAGTGTTCTC -3'
(R):5'- ACTCTTGTCAGGCAGCAAGC -3'
Posted On2016-07-06