Mutagenetix > Incidental Mutations

Incidental Mutation 'R5177:Dnajc13'

399613

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

042757-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R5177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 104230986 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 197 (H197Y)

Ref Sequence

ENSEMBL: ENSMUSP00000035170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

Predicted Effect

probably benign
Transcript: ENSMUST00000035170
AA Change: H197Y

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: H197Y

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186788
AA Change: H197Y

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: H197Y

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190600

Meta Mutation Damage Score

0.0744

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,285,295	R575Q	probably damaging	Het
AI464131	C	A	4: 41,498,407	E408*	probably null	Het
Arhgap22	T	G	14: 33,366,693	V377G	probably benign	Het
Asic4	T	C	1: 75,450,839	I3T	probably damaging	Het
Atp2b4	T	C	1: 133,728,768	T715A	probably benign	Het
Ccdc180	A	T	4: 45,917,508	H283L	probably damaging	Het
Cfb	A	G	17: 34,859,026	V976A	probably damaging	Het
Cltc	T	C	11: 86,705,163	T1250A	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dcbld1	T	A	10: 52,304,634	D131E	probably damaging	Het
Dmxl1	T	C	18: 49,893,584	S1920P	probably damaging	Het
Dpy19l1	C	T	9: 24,438,628		probably null	Het
Ears2	A	G	7: 122,044,460		probably benign	Het
Epgn	A	C	5: 91,028,277		probably benign	Het
Ern1	T	C	11: 106,411,775	T418A	probably benign	Het
F12	G	A	13: 55,420,168	P476S	probably benign	Het
Gal3st2c	C	T	1: 94,009,208	Q292*	probably null	Het
Galnt7	C	A	8: 57,584,027	Q109H	possibly damaging	Het
Gimap1	G	T	6: 48,743,098	G215W	probably damaging	Het
Gm28042	T	A	2: 120,041,601		probably null	Het
Gm5414	A	G	15: 101,625,817	I284T	possibly damaging	Het
Hddc3	A	G	7: 80,343,166	E10G	probably damaging	Het
Hmgxb3	T	C	18: 61,172,194	K31E	probably damaging	Het
Hspg2	A	C	4: 137,518,772	Y989S	probably damaging	Het
Kif12	G	A	4: 63,167,904	T402M	probably benign	Het
Klhdc4	A	T	8: 121,813,790	L115*	probably null	Het
Lama2	C	T	10: 27,190,703	V1061M	possibly damaging	Het
Llgl1	C	T	11: 60,712,007	T836I	possibly damaging	Het
Maats1	A	G	16: 38,332,321	S176P	probably benign	Het
Map4k4	A	G	1: 39,986,762	D304G	probably damaging	Het
Matn2	A	G	15: 34,433,514	Q915R	possibly damaging	Het
Myo18a	A	G	11: 77,864,842		probably benign	Het
Nbn	A	T	4: 15,965,132		probably null	Het
Nek8	G	A	11: 78,170,471	Q383*	probably null	Het
Nme7	T	G	1: 164,380,676	Y304*	probably null	Het
Nol8	A	T	13: 49,661,112	H214L	probably benign	Het
Nostrin	A	T	2: 69,175,754	I261F	possibly damaging	Het
Olfr46	A	G	7: 140,610,189	T8A	probably benign	Het
Olfr592	A	T	7: 103,187,503	I301L	probably benign	Het
Oprk1	T	G	1: 5,602,674	C345G	probably damaging	Het
Polrmt	T	C	10: 79,737,476	S998G	probably benign	Het
Ppp1r12c	T	A	7: 4,484,496	R393*	probably null	Het
Prpf3	T	A	3: 95,849,724		probably benign	Het
Rabl6	T	C	2: 25,585,373	M563V	probably benign	Het
Rasa2	C	A	9: 96,544,791	E775*	probably null	Het
Rc3h1	G	T	1: 160,951,652	V552L	probably damaging	Het
Rhot1	A	T	11: 80,246,766	N365Y	possibly damaging	Het
Rimbp3	G	A	16: 17,209,917	V402M	possibly damaging	Het
Rusc2	A	T	4: 43,421,805		probably null	Het
Slc25a11	T	C	11: 70,645,817	E141G	probably damaging	Het
Slc34a1	A	T	13: 55,401,162	I142F	probably damaging	Het
Socs6	A	C	18: 88,869,380	Y470*	probably null	Het
Sox12	A	T	2: 152,397,178	L174Q	unknown	Het
Srl	A	G	16: 4,496,403		probably null	Het
Tacc1	A	T	8: 25,201,221	V22E	probably damaging	Het
Thsd7a	A	T	6: 12,379,583	C947*	probably null	Het
Tlr12	A	C	4: 128,618,376	V27G	probably damaging	Het
Tmprss4	C	A	9: 45,173,962	V398L	probably benign	Het
Trip6	T	C	5: 137,312,172	D270G	probably damaging	Het
Uba5	T	G	9: 104,049,298	N355T	probably benign	Het
Ubr5	A	G	15: 38,006,517	Y1171H	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,018	L464P	possibly damaging	Het
Vmn2r57	A	G	7: 41,400,240	I695T	probably benign	Het
Vmn2r68	T	A	7: 85,221,991	I695L	probably damaging	Het
Vmn2r79	T	A	7: 87,001,969	M192K	probably damaging	Het
Vps16	G	T	2: 130,443,368	E782*	probably null	Het
Zfp783	A	G	6: 47,946,803		noncoding transcript	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5452:Dnajc13	UTSW	9	104192114	missense	probably benign	0.01
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACATCTCTTACCGAATGTCG -3'
(R):5'- GCTTATGGCTTCCTATTGCAAAC -3'

Sequencing Primer
(F):5'- CATCTCTTACCGAATGTCGAGGAG -3'
(R):5'- GGCTTCCTATTGCAAACTATTGTG -3'

Posted On

2016-07-06