Incidental Mutation 'R5177:Lama2'
ID399615
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.440) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 27190703 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1061 (V1061M)
Ref Sequence ENSEMBL: ENSMUSP00000090304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639] [ENSMUST00000189575]
PDB Structure
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR [X-RAY DIFFRACTION]
LAMININ ALPHA 2 CHAIN LG4-5 DOMAIN PAIR, CA1 SITE MUTANT [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE FIFTH LAMININ G-LIKE MODULE OF THE MOUSE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE LG1-3 REGION OF THE LAMININ ALPHA2 CHAIN [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092639
AA Change: V1061M

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899
AA Change: V1061M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000189575
AA Change: V1061M

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140716
Gene: ENSMUSG00000019899
AA Change: V1061M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 2.5e-131 SMART
EGF_Lam 283 337 1e-6 SMART
EGF_Lam 340 407 7.7e-11 SMART
EGF_Lam 410 462 2.6e-9 SMART
EGF_Lam 465 511 4.5e-6 SMART
LamB 574 706 1.4e-46 SMART
Pfam:Laminin_EGF 715 745 1.7e-2 PFAM
EGF_Lam 753 800 1.9e-12 SMART
EGF_Lam 803 858 1.4e-11 SMART
EGF_Lam 861 911 6.7e-14 SMART
EGF_Lam 914 960 3.6e-14 SMART
EGF_Lam 963 1007 2.9e-14 SMART
EGF_Lam 1010 1053 6.1e-15 SMART
EGF_Lam 1056 1099 1.1e-9 SMART
EGF_Lam 1102 1159 1.5e-11 SMART
LamB 1225 1349 1.4e-45 SMART
Meta Mutation Damage Score 0.1556 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
PIT4362001:Lama2 UTSW 10 27369136 missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27204905 missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 27101430 missense probably damaging 1.00
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4898:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
R7168:Lama2 UTSW 10 27366152 critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27231663 missense probably damaging 1.00
R7272:Lama2 UTSW 10 27124556 missense probably damaging 1.00
R7274:Lama2 UTSW 10 27119980 missense probably damaging 0.99
R7419:Lama2 UTSW 10 27266634 missense probably benign
R7423:Lama2 UTSW 10 27212226 missense probably benign 0.00
R7554:Lama2 UTSW 10 27155496 missense probably damaging 1.00
R7569:Lama2 UTSW 10 27265050 missense probably damaging 1.00
R7574:Lama2 UTSW 10 27006730 missense probably benign 0.03
R7584:Lama2 UTSW 10 27104261 missense possibly damaging 0.78
R7586:Lama2 UTSW 10 27101393 missense probably benign 0.00
R7603:Lama2 UTSW 10 27266680 missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27208393 missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26990924 missense probably damaging 0.97
R7841:Lama2 UTSW 10 27155533 missense probably benign 0.00
R7864:Lama2 UTSW 10 27056615 missense probably benign 0.08
R7960:Lama2 UTSW 10 26993098 missense probably benign 0.04
R7964:Lama2 UTSW 10 27223981 critical splice donor site probably null
R7980:Lama2 UTSW 10 27363613 missense probably damaging 0.98
R8013:Lama2 UTSW 10 27344498 missense probably benign 0.00
R8028:Lama2 UTSW 10 27328149 missense probably benign 0.13
R8097:Lama2 UTSW 10 27190664 nonsense probably null
R8100:Lama2 UTSW 10 27041117 missense probably benign 0.03
R8110:Lama2 UTSW 10 26990870 missense probably damaging 1.00
R8122:Lama2 UTSW 10 27054596 missense possibly damaging 0.87
R8264:Lama2 UTSW 10 27467222 missense probably benign 0.07
R8315:Lama2 UTSW 10 27422659 missense probably damaging 1.00
R8318:Lama2 UTSW 10 26984338 missense probably damaging 1.00
R8419:Lama2 UTSW 10 27422563 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGCTGCACTGTCCAGTTTG -3'
(R):5'- ATGCTATGTTCACTAATGTGTCCC -3'

Sequencing Primer
(F):5'- GTCCAGTTTGATCACTACAGGAGC -3'
(R):5'- GTTCACTAATGTGTCCCAAAGTC -3'
Posted On2016-07-06