Incidental Mutation 'R5177:Polrmt'
ID399619
Institutional Source Beutler Lab
Gene Symbol Polrmt
Ensembl Gene ENSMUSG00000020329
Gene Namepolymerase (RNA) mitochondrial (DNA directed)
Synonyms
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location79736123-79746581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79737476 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 998 (S998G)
Ref Sequence ENSEMBL: ENSMUSP00000124936 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020580] [ENSMUST00000020581] [ENSMUST00000099513] [ENSMUST00000159016] [ENSMUST00000162694]
Predicted Effect probably benign
Transcript: ENSMUST00000020580
AA Change: S1072G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000020580
Gene: ENSMUSG00000020329
AA Change: S1072G

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 802 1207 5.6e-169 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020581
SMART Domains Protein: ENSMUSP00000020581
Gene: ENSMUSG00000020331

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 140 183 5e-23 PFAM
Pfam:Ion_trans 184 447 3.3e-24 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099513
SMART Domains Protein: ENSMUSP00000097113
Gene: ENSMUSG00000020331

DomainStartEndE-ValueType
low complexity region 4 47 N/A INTRINSIC
low complexity region 106 128 N/A INTRINSIC
Pfam:Ion_trans_N 139 215 2.6e-47 PFAM
Pfam:Ion_trans 219 435 1.5e-20 PFAM
low complexity region 448 459 N/A INTRINSIC
Blast:cNMP 460 492 9e-13 BLAST
cNMP 517 630 4.79e-22 SMART
low complexity region 727 765 N/A INTRINSIC
low complexity region 778 800 N/A INTRINSIC
low complexity region 804 838 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159016
AA Change: S998G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124936
Gene: ENSMUSG00000020329
AA Change: S998G

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 601 6.27e-50 SMART
low complexity region 629 640 N/A INTRINSIC
Pfam:RNA_pol 727 1133 7.5e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160595
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160838
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161098
Predicted Effect unknown
Transcript: ENSMUST00000161662
AA Change: S257G
SMART Domains Protein: ENSMUSP00000124230
Gene: ENSMUSG00000020329
AA Change: S257G

DomainStartEndE-ValueType
Pfam:RNA_pol 29 120 6.7e-39 PFAM
Pfam:RNA_pol 119 393 2.7e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162687
Predicted Effect probably benign
Transcript: ENSMUST00000162694
SMART Domains Protein: ENSMUSP00000124556
Gene: ENSMUSG00000020329

DomainStartEndE-ValueType
low complexity region 37 45 N/A INTRINSIC
low complexity region 159 168 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 326 339 N/A INTRINSIC
RPOL_N 373 675 1.59e-92 SMART
low complexity region 703 714 N/A INTRINSIC
Pfam:RNA_pol 801 895 6.4e-34 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of phage and mitochondrial polymerases of lower eukaryotes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die before organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Polrmt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Polrmt APN 10 79737597 splice site probably null
IGL01145:Polrmt APN 10 79741137 missense probably benign 0.12
IGL01454:Polrmt APN 10 79743683 missense possibly damaging 0.60
IGL01511:Polrmt APN 10 79740151 missense probably benign 0.00
IGL01750:Polrmt APN 10 79739846 missense possibly damaging 0.84
IGL01766:Polrmt APN 10 79736568 missense possibly damaging 0.71
IGL01827:Polrmt APN 10 79738120 missense probably damaging 1.00
IGL02941:Polrmt APN 10 79737258 splice site probably benign
IGL02982:Polrmt APN 10 79738348 missense probably damaging 1.00
R0323:Polrmt UTSW 10 79741998 missense probably benign 0.41
R0379:Polrmt UTSW 10 79737611 missense possibly damaging 0.89
R0628:Polrmt UTSW 10 79739145 missense possibly damaging 0.89
R1017:Polrmt UTSW 10 79743509 nonsense probably null
R1846:Polrmt UTSW 10 79738209 missense probably damaging 1.00
R2082:Polrmt UTSW 10 79743512 missense probably benign 0.41
R2149:Polrmt UTSW 10 79740275 nonsense probably null
R2359:Polrmt UTSW 10 79736562 missense probably damaging 1.00
R4105:Polrmt UTSW 10 79741733 missense probably benign
R4381:Polrmt UTSW 10 79741808 missense possibly damaging 0.94
R4782:Polrmt UTSW 10 79739523 missense probably benign 0.04
R4902:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4904:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4916:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4938:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4963:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4964:Polrmt UTSW 10 79746551 start codon destroyed probably null 1.00
R4970:Polrmt UTSW 10 79736587 missense probably damaging 1.00
R5484:Polrmt UTSW 10 79742054 missense probably damaging 1.00
R5820:Polrmt UTSW 10 79738323 splice site probably null
R5910:Polrmt UTSW 10 79743497 missense probably benign 0.03
R5928:Polrmt UTSW 10 79740352 missense probably damaging 1.00
R6550:Polrmt UTSW 10 79739680 missense probably damaging 1.00
R6979:Polrmt UTSW 10 79746566 utr 5 prime probably null
R7233:Polrmt UTSW 10 79745785 splice site probably null
R7323:Polrmt UTSW 10 79740649 missense probably benign
R7505:Polrmt UTSW 10 79737883 missense probably benign 0.18
R7505:Polrmt UTSW 10 79743176 critical splice donor site probably null
R7777:Polrmt UTSW 10 79739188 missense probably benign 0.03
X0026:Polrmt UTSW 10 79740740 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCATCATGTGGGAGGAGTC -3'
(R):5'- GAGTGCCAACCTCATCTCTC -3'

Sequencing Primer
(F):5'- CATGTGGGAGGAGTCCAGGG -3'
(R):5'- TCATCTCTCACGCCGGATGG -3'
Posted On2016-07-06