Incidental Mutation 'R0455:Acvr2b'
ID39962
Institutional Source Beutler Lab
Gene Symbol Acvr2b
Ensembl Gene ENSMUSG00000061393
Gene Nameactivin receptor IIB
SynonymsActRIIB
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0455 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location119402118-119434995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119432609 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 399 (R399W)
Ref Sequence ENSEMBL: ENSMUSP00000150566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035093] [ENSMUST00000165044] [ENSMUST00000215746]
Predicted Effect probably damaging
Transcript: ENSMUST00000035093
AA Change: R415W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035093
Gene: ENSMUSG00000061393
AA Change: R415W

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.4e-13 PFAM
transmembrane domain 130 152 N/A INTRINSIC
Pfam:Pkinase 206 494 1.5e-55 PFAM
Pfam:Pkinase_Tyr 206 494 2.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165044
AA Change: R423W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126108
Gene: ENSMUSG00000061393
AA Change: R423W

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.3e-14 PFAM
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Pkinase_Tyr 214 502 1.7e-26 PFAM
Pfam:Pkinase 217 501 1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213431
Predicted Effect probably damaging
Transcript: ENSMUST00000215746
AA Change: R399W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217621
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene show abnormal lateral asymmetry and homeotic transformation of the axial skeleton, and die shortly after birth with extensive cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Acvr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Acvr2b APN 9 119432504 missense probably damaging 1.00
IGL02206:Acvr2b APN 9 119427998 nonsense probably null
IGL03022:Acvr2b APN 9 119427521 missense probably benign 0.10
IGL03131:Acvr2b APN 9 119431284 missense possibly damaging 0.92
R2131:Acvr2b UTSW 9 119432808 missense probably damaging 1.00
R4744:Acvr2b UTSW 9 119431262 missense probably damaging 1.00
R5278:Acvr2b UTSW 9 119432489 missense probably damaging 0.99
R5636:Acvr2b UTSW 9 119428309 missense probably damaging 1.00
R6196:Acvr2b UTSW 9 119433403 missense possibly damaging 0.71
R6253:Acvr2b UTSW 9 119428561 missense probably damaging 1.00
R6424:Acvr2b UTSW 9 119402579 missense probably benign
R6465:Acvr2b UTSW 9 119433303 missense probably damaging 1.00
R7096:Acvr2b UTSW 9 119428189 splice site probably null
R7102:Acvr2b UTSW 9 119432553 missense probably damaging 0.96
R7497:Acvr2b UTSW 9 119433286 missense probably benign
R8557:Acvr2b UTSW 9 119432588 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTCACTCTGCCTCAAACGGGATG -3'
(R):5'- CTTGTGGACAACCACCTCCTGAAG -3'

Sequencing Primer
(F):5'- TTACCCAACCTGGTGCATGG -3'
(R):5'- TGAAGCTCCTCCAGCGAAG -3'
Posted On2013-05-23