Incidental Mutation 'R5177:Rhot1'
ID399629
Institutional Source Beutler Lab
Gene Symbol Rhot1
Ensembl Gene ENSMUSG00000017686
Gene Nameras homolog family member T1
Synonyms2210403N23Rik, Arht1, C430039G08Rik, FLJ11040, Miro1
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location80209019-80267907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80246766 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 365 (N365Y)
Ref Sequence ENSEMBL: ENSMUSP00000090533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017831] [ENSMUST00000055056] [ENSMUST00000077451] [ENSMUST00000092857]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017831
AA Change: N365Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017831
Gene: ENSMUSG00000017686
AA Change: N365Y

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.5e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.6e-16 PFAM
Pfam:Ras 433 566 1.7e-6 PFAM
transmembrane domain 638 660 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000055056
AA Change: N365Y

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057669
Gene: ENSMUSG00000017686
AA Change: N365Y

DomainStartEndE-ValueType
Pfam:Arf 7 177 5.6e-6 PFAM
Pfam:Miro 19 134 2.5e-18 PFAM
Pfam:Ras 19 181 1.4e-20 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 231 319 5.4e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 353 427 1.8e-33 PFAM
Pfam:Miro 433 543 6.7e-16 PFAM
Pfam:Ras 433 577 1.6e-6 PFAM
transmembrane domain 647 669 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000077451
AA Change: N365Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000076664
Gene: ENSMUSG00000017686
AA Change: N365Y

DomainStartEndE-ValueType
Pfam:Roc 19 135 9.4e-11 PFAM
Pfam:Ras 19 181 9.1e-21 PFAM
EFh 201 229 6.75e0 SMART
Pfam:EF_assoc_2 232 318 8.3e-36 PFAM
EFh 321 349 1.67e0 SMART
Pfam:EF_assoc_1 354 426 7e-32 PFAM
Pfam:Ras 433 566 1.5e-6 PFAM
transmembrane domain 679 701 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000092857
AA Change: N365Y

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090533
Gene: ENSMUSG00000017686
AA Change: N365Y

DomainStartEndE-ValueType
small_GTPase 15 182 5.1e-8 SMART
EFh 201 229 3.3e-2 SMART
Pfam:EF_assoc_2 231 319 2.9e-33 PFAM
EFh 321 349 8.1e-3 SMART
Pfam:EF_assoc_1 353 427 1e-30 PFAM
Pfam:Miro 433 543 8e-15 PFAM
Pfam:Ras 433 566 2.5e-5 PFAM
transmembrane domain 606 628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134148
Predicted Effect unknown
Transcript: ENSMUST00000134894
AA Change: N126Y
SMART Domains Protein: ENSMUSP00000117941
Gene: ENSMUSG00000017686
AA Change: N126Y

DomainStartEndE-ValueType
Pfam:EF_assoc_2 1 80 1.3e-34 PFAM
Blast:EFh 83 111 2e-10 BLAST
Pfam:EF_assoc_1 116 188 4.3e-33 PFAM
Pfam:Ras 195 331 1.3e-7 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154362
Meta Mutation Damage Score 0.8588 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele die neonatally exhibiting cyanosis, respiratory failure, loss of brainstem cranial motor neurons, decreased cervical motor neuron number and phrenic nerve branching, and alterations in retrograde mitochondrial transport and run length in cortical axons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Rhot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Rhot1 APN 11 80226102 missense probably benign 0.27
IGL01335:Rhot1 APN 11 80250229 missense probably damaging 1.00
IGL01631:Rhot1 APN 11 80265774 missense probably damaging 1.00
IGL03009:Rhot1 APN 11 80220254 splice site probably null
IGL03106:Rhot1 APN 11 80242581 nonsense probably null
R0554:Rhot1 UTSW 11 80243438 nonsense probably null
R0720:Rhot1 UTSW 11 80223943 missense probably damaging 1.00
R1319:Rhot1 UTSW 11 80246021 missense probably damaging 0.98
R3825:Rhot1 UTSW 11 80226081 missense probably damaging 0.98
R4713:Rhot1 UTSW 11 80225602 missense probably benign 0.00
R4917:Rhot1 UTSW 11 80209201 utr 5 prime probably benign
R4971:Rhot1 UTSW 11 80233474 missense probably damaging 1.00
R5159:Rhot1 UTSW 11 80220272 missense probably damaging 1.00
R5231:Rhot1 UTSW 11 80227334 critical splice donor site probably null
R5659:Rhot1 UTSW 11 80250355 intron probably null
R5941:Rhot1 UTSW 11 80251170 intron probably benign
R6216:Rhot1 UTSW 11 80251059 missense probably benign 0.00
R6920:Rhot1 UTSW 11 80242095 missense probably benign 0.36
R6984:Rhot1 UTSW 11 80233484 nonsense probably null
R7199:Rhot1 UTSW 11 80246734 missense probably damaging 1.00
R7383:Rhot1 UTSW 11 80223934 missense probably damaging 1.00
R7453:Rhot1 UTSW 11 80248540 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATGAGTTTCTCAAAGCATGGC -3'
(R):5'- GAAGAAAACAGCCCTTCTTGAC -3'

Sequencing Primer
(F):5'- CTTTACTGGCGGAGAGAGC -3'
(R):5'- CAGCCCTTCTTGACAAACTTAG -3'
Posted On2016-07-06