Incidental Mutation 'R5177:Cltc'
ID399631
Institutional Source Beutler Lab
Gene Symbol Cltc
Ensembl Gene ENSMUSG00000047126
Gene Nameclathrin, heavy polypeptide (Hc)
SynonymsCHC
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86694351-86757565 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86705163 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1250 (T1250A)
Ref Sequence ENSEMBL: ENSMUSP00000099475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]
Predicted Effect possibly damaging
Transcript: ENSMUST00000060766
AA Change: T1254A

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: T1254A

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 5.3e-10 PFAM
Pfam:Clathrin_propel 152 191 1.5e-11 PFAM
Pfam:Clathrin_propel 202 238 1.2e-11 PFAM
Pfam:Clathrin_propel 257 292 2.2e-8 PFAM
Pfam:Clathrin_propel 300 334 8.6e-10 PFAM
Pfam:Clathrin-link 335 358 1.7e-17 PFAM
Pfam:Clathrin_H_link 360 425 7.1e-35 PFAM
low complexity region 449 462 N/A INTRINSIC
CLH 541 683 1.65e-41 SMART
CLH 690 832 1.24e-45 SMART
CLH 837 976 6.68e-42 SMART
CLH 983 1128 7.21e-47 SMART
CLH 1132 1273 7.91e-44 SMART
CLH 1278 1424 1.59e-48 SMART
CLH 1427 1586 8.36e-43 SMART
low complexity region 1666 1677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103186
AA Change: T1250A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: T1250A

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 2e-7 PFAM
Pfam:Clathrin_propel 148 187 3.8e-9 PFAM
Pfam:Clathrin_propel 198 234 3.8e-9 PFAM
Pfam:Clathrin-link 331 354 3.5e-17 PFAM
Pfam:Clathrin_H_link 356 421 1.9e-35 PFAM
low complexity region 445 458 N/A INTRINSIC
CLH 537 679 1.65e-41 SMART
CLH 686 828 1.24e-45 SMART
CLH 833 972 6.68e-42 SMART
CLH 979 1124 7.21e-47 SMART
CLH 1128 1269 7.91e-44 SMART
CLH 1274 1420 1.59e-48 SMART
CLH 1423 1582 8.36e-43 SMART
low complexity region 1662 1673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124385
SMART Domains Protein: ENSMUSP00000117674
Gene: ENSMUSG00000047126

DomainStartEndE-ValueType
Pfam:Clathrin 1 99 4.4e-23 PFAM
low complexity region 203 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134999
Meta Mutation Damage Score 0.1731 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Cltc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Cltc APN 11 86702248 missense probably benign 0.43
IGL01503:Cltc APN 11 86695700 splice site probably benign
IGL01649:Cltc APN 11 86726400 missense probably benign 0.16
IGL01896:Cltc APN 11 86725133 missense probably damaging 1.00
IGL02005:Cltc APN 11 86730219 missense possibly damaging 0.86
IGL02125:Cltc APN 11 86704810 unclassified probably benign
IGL02166:Cltc APN 11 86704088 missense probably benign 0.00
IGL02186:Cltc APN 11 86704985 missense possibly damaging 0.55
IGL02186:Cltc APN 11 86704986 missense possibly damaging 0.55
IGL02214:Cltc APN 11 86732586 missense probably benign 0.08
IGL02227:Cltc APN 11 86697340 missense possibly damaging 0.85
IGL02471:Cltc APN 11 86718034 missense probably damaging 1.00
IGL02607:Cltc APN 11 86706714 missense probably benign 0.00
IGL02888:Cltc APN 11 86757297 utr 5 prime probably benign
IGL03226:Cltc APN 11 86720287 missense probably damaging 1.00
IGL03337:Cltc APN 11 86703683 missense possibly damaging 0.95
R0468:Cltc UTSW 11 86704626 unclassified probably benign
R0487:Cltc UTSW 11 86733664 missense probably damaging 1.00
R0515:Cltc UTSW 11 86709039 missense probably benign 0.25
R0631:Cltc UTSW 11 86712613 missense probably benign 0.03
R0759:Cltc UTSW 11 86737082 missense probably null 0.91
R1635:Cltc UTSW 11 86757279 missense probably benign 0.00
R1671:Cltc UTSW 11 86732595 missense possibly damaging 0.88
R1695:Cltc UTSW 11 86701060 critical splice donor site probably null
R1737:Cltc UTSW 11 86733727 missense probably damaging 1.00
R1747:Cltc UTSW 11 86707081 missense probably damaging 1.00
R1880:Cltc UTSW 11 86712631 missense probably damaging 1.00
R2291:Cltc UTSW 11 86733622 missense probably benign 0.35
R3031:Cltc UTSW 11 86730332 missense probably damaging 1.00
R4012:Cltc UTSW 11 86757261 missense probably benign 0.12
R4022:Cltc UTSW 11 86720348 missense probably damaging 0.96
R4394:Cltc UTSW 11 86733630 missense probably damaging 0.97
R4654:Cltc UTSW 11 86726370 missense probably benign 0.10
R4807:Cltc UTSW 11 86701076 intron probably benign
R4837:Cltc UTSW 11 86695648 missense probably benign 0.00
R4965:Cltc UTSW 11 86707501 missense probably damaging 0.99
R5072:Cltc UTSW 11 86717968 missense possibly damaging 0.86
R5113:Cltc UTSW 11 86722321 missense probably damaging 0.98
R5126:Cltc UTSW 11 86712669 missense probably damaging 1.00
R5609:Cltc UTSW 11 86730267 missense probably damaging 0.99
R5610:Cltc UTSW 11 86721646 missense probably benign 0.00
R5677:Cltc UTSW 11 86705242 missense probably damaging 1.00
R5999:Cltc UTSW 11 86704129 missense possibly damaging 0.93
R6197:Cltc UTSW 11 86720362 missense probably benign 0.01
R6198:Cltc UTSW 11 86720362 missense probably benign 0.01
R6264:Cltc UTSW 11 86705258 missense probably damaging 1.00
R6395:Cltc UTSW 11 86725180 missense probably damaging 0.97
R6818:Cltc UTSW 11 86704228 missense possibly damaging 0.86
R6894:Cltc UTSW 11 86712602 nonsense probably null
R7196:Cltc UTSW 11 86706831 missense probably damaging 1.00
R7438:Cltc UTSW 11 86725228 missense probably benign 0.01
R7621:Cltc UTSW 11 86707486 missense probably benign 0.03
R7637:Cltc UTSW 11 86730332 missense probably damaging 1.00
R7729:Cltc UTSW 11 86721648 missense probably benign
R7769:Cltc UTSW 11 86719493 missense probably damaging 1.00
R7817:Cltc UTSW 11 86725123 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTCTTTCCCATCTACACAGG -3'
(R):5'- GGGATTAGGCTGAAACCTGTG -3'

Sequencing Primer
(F):5'- TCTTTCCCATCTACACAGGCAAAG -3'
(R):5'- AGGCTGAAACCTGTGTTTTACTGATC -3'
Posted On2016-07-06