Mutagenetix > Incidental Mutations

Incidental Mutation 'R5177:Cltc'

399631

Institutional Source

Beutler Lab

Gene Symbol

Cltc

Ensembl Gene

ENSMUSG00000047126

Gene Name

clathrin, heavy polypeptide (Hc)

Synonyms

CHC

MMRRC Submission

042757-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R5177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86694351-86757565 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86705163 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1250 (T1250A)

Ref Sequence

ENSEMBL: ENSMUSP00000099475 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]

AlphaFold

Q68FD5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060766
AA Change: T1254A

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: T1254A

Domain	Start	End	E-Value	Type
Pfam:Clathrin_propel	19	56	5.3e-10	PFAM
Pfam:Clathrin_propel	152	191	1.5e-11	PFAM
Pfam:Clathrin_propel	202	238	1.2e-11	PFAM
Pfam:Clathrin_propel	257	292	2.2e-8	PFAM
Pfam:Clathrin_propel	300	334	8.6e-10	PFAM
Pfam:Clathrin-link	335	358	1.7e-17	PFAM
Pfam:Clathrin_H_link	360	425	7.1e-35	PFAM
low complexity region	449	462	N/A	INTRINSIC
CLH	541	683	1.65e-41	SMART
CLH	690	832	1.24e-45	SMART
CLH	837	976	6.68e-42	SMART
CLH	983	1128	7.21e-47	SMART
CLH	1132	1273	7.91e-44	SMART
CLH	1278	1424	1.59e-48	SMART
CLH	1427	1586	8.36e-43	SMART
low complexity region	1666	1677	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103186
AA Change: T1250A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: T1250A

Domain	Start	End	E-Value	Type
Pfam:Clathrin_propel	19	56	2e-7	PFAM
Pfam:Clathrin_propel	148	187	3.8e-9	PFAM
Pfam:Clathrin_propel	198	234	3.8e-9	PFAM
Pfam:Clathrin-link	331	354	3.5e-17	PFAM
Pfam:Clathrin_H_link	356	421	1.9e-35	PFAM
low complexity region	445	458	N/A	INTRINSIC
CLH	537	679	1.65e-41	SMART
CLH	686	828	1.24e-45	SMART
CLH	833	972	6.68e-42	SMART
CLH	979	1124	7.21e-47	SMART
CLH	1128	1269	7.91e-44	SMART
CLH	1274	1420	1.59e-48	SMART
CLH	1423	1582	8.36e-43	SMART
low complexity region	1662	1673	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124385

SMART Domains

Protein: ENSMUSP00000117674
Gene: ENSMUSG00000047126

Domain	Start	End	E-Value	Type
Pfam:Clathrin	1	99	4.4e-23	PFAM
low complexity region	203	214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134999

Meta Mutation Damage Score

0.1731

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,285,295	R575Q	probably damaging	Het
AI464131	C	A	4: 41,498,407	E408*	probably null	Het
Arhgap22	T	G	14: 33,366,693	V377G	probably benign	Het
Asic4	T	C	1: 75,450,839	I3T	probably damaging	Het
Atp2b4	T	C	1: 133,728,768	T715A	probably benign	Het
Ccdc180	A	T	4: 45,917,508	H283L	probably damaging	Het
Cfb	A	G	17: 34,859,026	V976A	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dcbld1	T	A	10: 52,304,634	D131E	probably damaging	Het
Dmxl1	T	C	18: 49,893,584	S1920P	probably damaging	Het
Dnajc13	G	A	9: 104,230,986	H197Y	probably benign	Het
Dpy19l1	C	T	9: 24,438,628		probably null	Het
Ears2	A	G	7: 122,044,460		probably benign	Het
Epgn	A	C	5: 91,028,277		probably benign	Het
Ern1	T	C	11: 106,411,775	T418A	probably benign	Het
F12	G	A	13: 55,420,168	P476S	probably benign	Het
Gal3st2c	C	T	1: 94,009,208	Q292*	probably null	Het
Galnt7	C	A	8: 57,584,027	Q109H	possibly damaging	Het
Gimap1	G	T	6: 48,743,098	G215W	probably damaging	Het
Gm28042	T	A	2: 120,041,601		probably null	Het
Gm5414	A	G	15: 101,625,817	I284T	possibly damaging	Het
Hddc3	A	G	7: 80,343,166	E10G	probably damaging	Het
Hmgxb3	T	C	18: 61,172,194	K31E	probably damaging	Het
Hspg2	A	C	4: 137,518,772	Y989S	probably damaging	Het
Kif12	G	A	4: 63,167,904	T402M	probably benign	Het
Klhdc4	A	T	8: 121,813,790	L115*	probably null	Het
Lama2	C	T	10: 27,190,703	V1061M	possibly damaging	Het
Llgl1	C	T	11: 60,712,007	T836I	possibly damaging	Het
Maats1	A	G	16: 38,332,321	S176P	probably benign	Het
Map4k4	A	G	1: 39,986,762	D304G	probably damaging	Het
Matn2	A	G	15: 34,433,514	Q915R	possibly damaging	Het
Myo18a	A	G	11: 77,864,842		probably benign	Het
Nbn	A	T	4: 15,965,132		probably null	Het
Nek8	G	A	11: 78,170,471	Q383*	probably null	Het
Nme7	T	G	1: 164,380,676	Y304*	probably null	Het
Nol8	A	T	13: 49,661,112	H214L	probably benign	Het
Nostrin	A	T	2: 69,175,754	I261F	possibly damaging	Het
Olfr46	A	G	7: 140,610,189	T8A	probably benign	Het
Olfr592	A	T	7: 103,187,503	I301L	probably benign	Het
Oprk1	T	G	1: 5,602,674	C345G	probably damaging	Het
Polrmt	T	C	10: 79,737,476	S998G	probably benign	Het
Ppp1r12c	T	A	7: 4,484,496	R393*	probably null	Het
Prpf3	T	A	3: 95,849,724		probably benign	Het
Rabl6	T	C	2: 25,585,373	M563V	probably benign	Het
Rasa2	C	A	9: 96,544,791	E775*	probably null	Het
Rc3h1	G	T	1: 160,951,652	V552L	probably damaging	Het
Rhot1	A	T	11: 80,246,766	N365Y	possibly damaging	Het
Rimbp3	G	A	16: 17,209,917	V402M	possibly damaging	Het
Rusc2	A	T	4: 43,421,805		probably null	Het
Slc25a11	T	C	11: 70,645,817	E141G	probably damaging	Het
Slc34a1	A	T	13: 55,401,162	I142F	probably damaging	Het
Socs6	A	C	18: 88,869,380	Y470*	probably null	Het
Sox12	A	T	2: 152,397,178	L174Q	unknown	Het
Srl	A	G	16: 4,496,403		probably null	Het
Tacc1	A	T	8: 25,201,221	V22E	probably damaging	Het
Thsd7a	A	T	6: 12,379,583	C947*	probably null	Het
Tlr12	A	C	4: 128,618,376	V27G	probably damaging	Het
Tmprss4	C	A	9: 45,173,962	V398L	probably benign	Het
Trip6	T	C	5: 137,312,172	D270G	probably damaging	Het
Uba5	T	G	9: 104,049,298	N355T	probably benign	Het
Ubr5	A	G	15: 38,006,517	Y1171H	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,018	L464P	possibly damaging	Het
Vmn2r57	A	G	7: 41,400,240	I695T	probably benign	Het
Vmn2r68	T	A	7: 85,221,991	I695L	probably damaging	Het
Vmn2r79	T	A	7: 87,001,969	M192K	probably damaging	Het
Vps16	G	T	2: 130,443,368	E782*	probably null	Het
Zfp783	A	G	6: 47,946,803		noncoding transcript	Het

Other mutations in Cltc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Cltc	APN	11	86702248	missense	probably benign	0.43
IGL01503:Cltc	APN	11	86695700	splice site	probably benign
IGL01649:Cltc	APN	11	86726400	missense	probably benign	0.16
IGL01896:Cltc	APN	11	86725133	missense	probably damaging	1.00
IGL02005:Cltc	APN	11	86730219	missense	possibly damaging	0.86
IGL02125:Cltc	APN	11	86704810	unclassified	probably benign
IGL02166:Cltc	APN	11	86704088	missense	probably benign	0.00
IGL02186:Cltc	APN	11	86704985	missense	possibly damaging	0.55
IGL02186:Cltc	APN	11	86704986	missense	possibly damaging	0.55
IGL02214:Cltc	APN	11	86732586	missense	probably benign	0.08
IGL02227:Cltc	APN	11	86697340	missense	possibly damaging	0.85
IGL02471:Cltc	APN	11	86718034	missense	probably damaging	1.00
IGL02607:Cltc	APN	11	86706714	missense	probably benign	0.00
IGL02888:Cltc	APN	11	86757297	utr 5 prime	probably benign
IGL03226:Cltc	APN	11	86720287	missense	probably damaging	1.00
IGL03337:Cltc	APN	11	86703683	missense	possibly damaging	0.95
Buckey	UTSW	11	86720362	missense	probably benign	0.01
fuller	UTSW	11	86704160	missense	possibly damaging	0.79
Geodesic	UTSW	11	86733630	missense	probably damaging	0.97
R0468:Cltc	UTSW	11	86704626	unclassified	probably benign
R0487:Cltc	UTSW	11	86733664	missense	probably damaging	1.00
R0515:Cltc	UTSW	11	86709039	missense	probably benign	0.25
R0631:Cltc	UTSW	11	86712613	missense	probably benign	0.03
R0759:Cltc	UTSW	11	86737082	missense	probably null	0.91
R1635:Cltc	UTSW	11	86757279	missense	probably benign	0.00
R1671:Cltc	UTSW	11	86732595	missense	possibly damaging	0.88
R1695:Cltc	UTSW	11	86701060	critical splice donor site	probably null
R1737:Cltc	UTSW	11	86733727	missense	probably damaging	1.00
R1747:Cltc	UTSW	11	86707081	missense	probably damaging	1.00
R1880:Cltc	UTSW	11	86712631	missense	probably damaging	1.00
R2291:Cltc	UTSW	11	86733622	missense	probably benign	0.35
R3031:Cltc	UTSW	11	86730332	missense	probably damaging	1.00
R4012:Cltc	UTSW	11	86757261	missense	probably benign	0.12
R4022:Cltc	UTSW	11	86720348	missense	probably damaging	0.96
R4394:Cltc	UTSW	11	86733630	missense	probably damaging	0.97
R4654:Cltc	UTSW	11	86726370	missense	probably benign	0.10
R4807:Cltc	UTSW	11	86701076	intron	probably benign
R4837:Cltc	UTSW	11	86695648	missense	probably benign	0.00
R4965:Cltc	UTSW	11	86707501	missense	probably damaging	0.99
R5072:Cltc	UTSW	11	86717968	missense	possibly damaging	0.86
R5113:Cltc	UTSW	11	86722321	missense	probably damaging	0.98
R5126:Cltc	UTSW	11	86712669	missense	probably damaging	1.00
R5609:Cltc	UTSW	11	86730267	missense	probably damaging	0.99
R5610:Cltc	UTSW	11	86721646	missense	probably benign	0.00
R5677:Cltc	UTSW	11	86705242	missense	probably damaging	1.00
R5999:Cltc	UTSW	11	86704129	missense	possibly damaging	0.93
R6197:Cltc	UTSW	11	86720362	missense	probably benign	0.01
R6198:Cltc	UTSW	11	86720362	missense	probably benign	0.01
R6264:Cltc	UTSW	11	86705258	missense	probably damaging	1.00
R6395:Cltc	UTSW	11	86725180	missense	probably damaging	0.97
R6818:Cltc	UTSW	11	86704228	missense	possibly damaging	0.86
R6894:Cltc	UTSW	11	86712602	nonsense	probably null
R7196:Cltc	UTSW	11	86706831	missense	probably damaging	1.00
R7438:Cltc	UTSW	11	86725228	missense	probably benign	0.01
R7621:Cltc	UTSW	11	86707486	missense	probably benign	0.03
R7637:Cltc	UTSW	11	86730332	missense	probably damaging	1.00
R7729:Cltc	UTSW	11	86721648	missense	probably benign
R7769:Cltc	UTSW	11	86719493	missense	probably damaging	1.00
R7817:Cltc	UTSW	11	86725123	missense	probably damaging	1.00
R7944:Cltc	UTSW	11	86737141	missense	probably benign	0.01
R7945:Cltc	UTSW	11	86737141	missense	probably benign	0.01
R8040:Cltc	UTSW	11	86725205	missense	probably damaging	1.00
R8105:Cltc	UTSW	11	86707612	missense	probably damaging	0.98
R8203:Cltc	UTSW	11	86704160	missense	possibly damaging	0.79
R8297:Cltc	UTSW	11	86712631	missense	probably damaging	1.00
R8304:Cltc	UTSW	11	86725261	missense	probably benign	0.01
R8419:Cltc	UTSW	11	86707566	missense	probably benign	0.01
R8673:Cltc	UTSW	11	86757375	start gained	probably benign
R8940:Cltc	UTSW	11	86730246	missense	probably benign	0.30
R8958:Cltc	UTSW	11	86695577	missense	possibly damaging	0.86
R9182:Cltc	UTSW	11	86705156	missense	probably damaging	1.00
R9188:Cltc	UTSW	11	86737166	missense	probably damaging	0.98
R9293:Cltc	UTSW	11	86712620	missense	possibly damaging	0.47
R9456:Cltc	UTSW	11	86702411	missense	probably benign	0.38
Z1176:Cltc	UTSW	11	86702632	missense	probably benign	0.16

Predicted Primers

PCR Primer
(F):5'- GAACTCTTTCCCATCTACACAGG -3'
(R):5'- GGGATTAGGCTGAAACCTGTG -3'

Sequencing Primer
(F):5'- TCTTTCCCATCTACACAGGCAAAG -3'
(R):5'- AGGCTGAAACCTGTGTTTTACTGATC -3'

Posted On

2016-07-06