Mutagenetix > Incidental Mutations

Incidental Mutation 'R5177:Cltc'

399631

Institutional Source

Beutler Lab

Gene Symbol

Cltc

Ensembl Gene

ENSMUSG00000047126

Gene Name

clathrin, heavy polypeptide (Hc)

Synonyms

CHC

MMRRC Submission

042757-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.963) question?

Stock #

R5177 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86694351-86757565 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86705163 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1250 (T1250A)

Ref Sequence

ENSEMBL: ENSMUSP00000099475 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060766
AA Change: T1254A

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: T1254A

Domain	Start	End	E-Value	Type
Pfam:Clathrin_propel	19	56	5.3e-10	PFAM
Pfam:Clathrin_propel	152	191	1.5e-11	PFAM
Pfam:Clathrin_propel	202	238	1.2e-11	PFAM
Pfam:Clathrin_propel	257	292	2.2e-8	PFAM
Pfam:Clathrin_propel	300	334	8.6e-10	PFAM
Pfam:Clathrin-link	335	358	1.7e-17	PFAM
Pfam:Clathrin_H_link	360	425	7.1e-35	PFAM
low complexity region	449	462	N/A	INTRINSIC
CLH	541	683	1.65e-41	SMART
CLH	690	832	1.24e-45	SMART
CLH	837	976	6.68e-42	SMART
CLH	983	1128	7.21e-47	SMART
CLH	1132	1273	7.91e-44	SMART
CLH	1278	1424	1.59e-48	SMART
CLH	1427	1586	8.36e-43	SMART
low complexity region	1666	1677	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103186
AA Change: T1250A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: T1250A

Domain	Start	End	E-Value	Type
Pfam:Clathrin_propel	19	56	2e-7	PFAM
Pfam:Clathrin_propel	148	187	3.8e-9	PFAM
Pfam:Clathrin_propel	198	234	3.8e-9	PFAM
Pfam:Clathrin-link	331	354	3.5e-17	PFAM
Pfam:Clathrin_H_link	356	421	1.9e-35	PFAM
low complexity region	445	458	N/A	INTRINSIC
CLH	537	679	1.65e-41	SMART
CLH	686	828	1.24e-45	SMART
CLH	833	972	6.68e-42	SMART
CLH	979	1124	7.21e-47	SMART
CLH	1128	1269	7.91e-44	SMART
CLH	1274	1420	1.59e-48	SMART
CLH	1423	1582	8.36e-43	SMART
low complexity region	1662	1673	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124385

SMART Domains

Protein: ENSMUSP00000117674
Gene: ENSMUSG00000047126

Domain	Start	End	E-Value	Type
Pfam:Clathrin	1	99	4.4e-23	PFAM
low complexity region	203	214	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134999

Meta Mutation Damage Score

0.1731

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

97% (71/73)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	C	T	2: 69,285,295	R575Q	probably damaging	Het
AI464131	C	A	4: 41,498,407	E408*	probably null	Het
Arhgap22	T	G	14: 33,366,693	V377G	probably benign	Het
Asic4	T	C	1: 75,450,839	I3T	probably damaging	Het
Atp2b4	T	C	1: 133,728,768	T715A	probably benign	Het
Ccdc180	A	T	4: 45,917,508	H283L	probably damaging	Het
Cfb	A	G	17: 34,859,026	V976A	probably damaging	Het
Cylc2	T	C	4: 51,228,587		probably benign	Het
Dcbld1	T	A	10: 52,304,634	D131E	probably damaging	Het
Dmxl1	T	C	18: 49,893,584	S1920P	probably damaging	Het
Dnajc13	G	A	9: 104,230,986	H197Y	probably benign	Het
Dpy19l1	C	T	9: 24,438,628		probably null	Het
Ears2	A	G	7: 122,044,460		probably benign	Het
Epgn	A	C	5: 91,028,277		probably benign	Het
Ern1	T	C	11: 106,411,775	T418A	probably benign	Het
F12	G	A	13: 55,420,168	P476S	probably benign	Het
Gal3st2c	C	T	1: 94,009,208	Q292*	probably null	Het
Galnt7	C	A	8: 57,584,027	Q109H	possibly damaging	Het
Gimap1	G	T	6: 48,743,098	G215W	probably damaging	Het
Gm28042	T	A	2: 120,041,601		probably null	Het
Gm5414	A	G	15: 101,625,817	I284T	possibly damaging	Het
Hddc3	A	G	7: 80,343,166	E10G	probably damaging	Het
Hmgxb3	T	C	18: 61,172,194	K31E	probably damaging	Het
Hspg2	A	C	4: 137,518,772	Y989S	probably damaging	Het
Kif12	G	A	4: 63,167,904	T402M	probably benign	Het
Klhdc4	A	T	8: 121,813,790	L115*	probably null	Het
Lama2	C	T	10: 27,190,703	V1061M	possibly damaging	Het
Llgl1	C	T	11: 60,712,007	T836I	possibly damaging	Het
Maats1	A	G	16: 38,332,321	S176P	probably benign	Het
Map4k4	A	G	1: 39,986,762	D304G	probably damaging	Het
Matn2	A	G	15: 34,433,514	Q915R	possibly damaging	Het
Myo18a	A	G	11: 77,864,842		probably benign	Het
Nbn	A	T	4: 15,965,132		probably null	Het
Nek8	G	A	11: 78,170,471	Q383*	probably null	Het
Nme7	T	G	1: 164,380,676	Y304*	probably null	Het
Nol8	A	T	13: 49,661,112	H214L	probably benign	Het
Nostrin	A	T	2: 69,175,754	I261F	possibly damaging	Het
Olfr46	A	G	7: 140,610,189	T8A	probably benign	Het
Olfr592	A	T	7: 103,187,503	I301L	probably benign	Het
Oprk1	T	G	1: 5,602,674	C345G	probably damaging	Het
Polrmt	T	C	10: 79,737,476	S998G	probably benign	Het
Ppp1r12c	T	A	7: 4,484,496	R393*	probably null	Het
Prpf3	T	A	3: 95,849,724		probably benign	Het
Rabl6	T	C	2: 25,585,373	M563V	probably benign	Het
Rasa2	C	A	9: 96,544,791	E775*	probably null	Het
Rc3h1	G	T	1: 160,951,652	V552L	probably damaging	Het
Rhot1	A	T	11: 80,246,766	N365Y	possibly damaging	Het
Rimbp3	G	A	16: 17,209,917	V402M	possibly damaging	Het
Rusc2	A	T	4: 43,421,805		probably null	Het
Slc25a11	T	C	11: 70,645,817	E141G	probably damaging	Het
Slc34a1	A	T	13: 55,401,162	I142F	probably damaging	Het
Socs6	A	C	18: 88,869,380	Y470*	probably null	Het
Sox12	A	T	2: 152,397,178	L174Q	unknown	Het
Srl	A	G	16: 4,496,403		probably null	Het
Tacc1	A	T	8: 25,201,221	V22E	probably damaging	Het
Thsd7a	A	T	6: 12,379,583	C947*	probably null	Het
Tlr12	A	C	4: 128,618,376	V27G	probably damaging	Het
Tmprss4	C	A	9: 45,173,962	V398L	probably benign	Het
Trip6	T	C	5: 137,312,172	D270G	probably damaging	Het
Uba5	T	G	9: 104,049,298	N355T	probably benign	Het
Ubr5	A	G	15: 38,006,517	Y1171H	probably benign	Het
Uhrf1bp1	T	C	17: 27,885,018	L464P	possibly damaging	Het
Vmn2r57	A	G	7: 41,400,240	I695T	probably benign	Het
Vmn2r68	T	A	7: 85,221,991	I695L	probably damaging	Het
Vmn2r79	T	A	7: 87,001,969	M192K	probably damaging	Het
Vps16	G	T	2: 130,443,368	E782*	probably null	Het
Zfp783	A	G	6: 47,946,803		noncoding transcript	Het

Other mutations in Cltc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01457:Cltc	APN	11	86702248	missense	probably benign	0.43
IGL01503:Cltc	APN	11	86695700	splice site	probably benign
IGL01649:Cltc	APN	11	86726400	missense	probably benign	0.16
IGL01896:Cltc	APN	11	86725133	missense	probably damaging	1.00
IGL02005:Cltc	APN	11	86730219	missense	possibly damaging	0.86
IGL02125:Cltc	APN	11	86704810	unclassified	probably benign
IGL02166:Cltc	APN	11	86704088	missense	probably benign	0.00
IGL02186:Cltc	APN	11	86704985	missense	possibly damaging	0.55
IGL02186:Cltc	APN	11	86704986	missense	possibly damaging	0.55
IGL02214:Cltc	APN	11	86732586	missense	probably benign	0.08
IGL02227:Cltc	APN	11	86697340	missense	possibly damaging	0.85
IGL02471:Cltc	APN	11	86718034	missense	probably damaging	1.00
IGL02607:Cltc	APN	11	86706714	missense	probably benign	0.00
IGL02888:Cltc	APN	11	86757297	utr 5 prime	probably benign
IGL03226:Cltc	APN	11	86720287	missense	probably damaging	1.00
IGL03337:Cltc	APN	11	86703683	missense	possibly damaging	0.95
R0468:Cltc	UTSW	11	86704626	unclassified	probably benign
R0487:Cltc	UTSW	11	86733664	missense	probably damaging	1.00
R0515:Cltc	UTSW	11	86709039	missense	probably benign	0.25
R0631:Cltc	UTSW	11	86712613	missense	probably benign	0.03
R0759:Cltc	UTSW	11	86737082	missense	probably null	0.91
R1635:Cltc	UTSW	11	86757279	missense	probably benign	0.00
R1671:Cltc	UTSW	11	86732595	missense	possibly damaging	0.88
R1695:Cltc	UTSW	11	86701060	critical splice donor site	probably null
R1737:Cltc	UTSW	11	86733727	missense	probably damaging	1.00
R1747:Cltc	UTSW	11	86707081	missense	probably damaging	1.00
R1880:Cltc	UTSW	11	86712631	missense	probably damaging	1.00
R2291:Cltc	UTSW	11	86733622	missense	probably benign	0.35
R3031:Cltc	UTSW	11	86730332	missense	probably damaging	1.00
R4012:Cltc	UTSW	11	86757261	missense	probably benign	0.12
R4022:Cltc	UTSW	11	86720348	missense	probably damaging	0.96
R4394:Cltc	UTSW	11	86733630	missense	probably damaging	0.97
R4654:Cltc	UTSW	11	86726370	missense	probably benign	0.10
R4807:Cltc	UTSW	11	86701076	intron	probably benign
R4837:Cltc	UTSW	11	86695648	missense	probably benign	0.00
R4965:Cltc	UTSW	11	86707501	missense	probably damaging	0.99
R5072:Cltc	UTSW	11	86717968	missense	possibly damaging	0.86
R5113:Cltc	UTSW	11	86722321	missense	probably damaging	0.98
R5126:Cltc	UTSW	11	86712669	missense	probably damaging	1.00
R5609:Cltc	UTSW	11	86730267	missense	probably damaging	0.99
R5610:Cltc	UTSW	11	86721646	missense	probably benign	0.00
R5677:Cltc	UTSW	11	86705242	missense	probably damaging	1.00
R5999:Cltc	UTSW	11	86704129	missense	possibly damaging	0.93
R6197:Cltc	UTSW	11	86720362	missense	probably benign	0.01
R6198:Cltc	UTSW	11	86720362	missense	probably benign	0.01
R6264:Cltc	UTSW	11	86705258	missense	probably damaging	1.00
R6395:Cltc	UTSW	11	86725180	missense	probably damaging	0.97
R6818:Cltc	UTSW	11	86704228	missense	possibly damaging	0.86
R6894:Cltc	UTSW	11	86712602	nonsense	probably null
R7196:Cltc	UTSW	11	86706831	missense	probably damaging	1.00
R7438:Cltc	UTSW	11	86725228	missense	probably benign	0.01
R7621:Cltc	UTSW	11	86707486	missense	probably benign	0.03
R7637:Cltc	UTSW	11	86730332	missense	probably damaging	1.00
R7729:Cltc	UTSW	11	86721648	missense	probably benign
R7769:Cltc	UTSW	11	86719493	missense	probably damaging	1.00
R7817:Cltc	UTSW	11	86725123	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAACTCTTTCCCATCTACACAGG -3'
(R):5'- GGGATTAGGCTGAAACCTGTG -3'

Sequencing Primer
(F):5'- TCTTTCCCATCTACACAGGCAAAG -3'
(R):5'- AGGCTGAAACCTGTGTTTTACTGATC -3'

Posted On

2016-07-06