Incidental Mutation 'R5177:Cltc'
ID 399631
Institutional Source Beutler Lab
Gene Symbol Cltc
Ensembl Gene ENSMUSG00000047126
Gene Name clathrin heavy chain
Synonyms CHC
MMRRC Submission 042757-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.957) question?
Stock # R5177 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 86585177-86648391 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86595989 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1250 (T1250A)
Ref Sequence ENSEMBL: ENSMUSP00000099475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060766] [ENSMUST00000103186]
AlphaFold Q68FD5
Predicted Effect possibly damaging
Transcript: ENSMUST00000060766
AA Change: T1254A

PolyPhen 2 Score 0.569 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000050220
Gene: ENSMUSG00000047126
AA Change: T1254A

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 5.3e-10 PFAM
Pfam:Clathrin_propel 152 191 1.5e-11 PFAM
Pfam:Clathrin_propel 202 238 1.2e-11 PFAM
Pfam:Clathrin_propel 257 292 2.2e-8 PFAM
Pfam:Clathrin_propel 300 334 8.6e-10 PFAM
Pfam:Clathrin-link 335 358 1.7e-17 PFAM
Pfam:Clathrin_H_link 360 425 7.1e-35 PFAM
low complexity region 449 462 N/A INTRINSIC
CLH 541 683 1.65e-41 SMART
CLH 690 832 1.24e-45 SMART
CLH 837 976 6.68e-42 SMART
CLH 983 1128 7.21e-47 SMART
CLH 1132 1273 7.91e-44 SMART
CLH 1278 1424 1.59e-48 SMART
CLH 1427 1586 8.36e-43 SMART
low complexity region 1666 1677 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103186
AA Change: T1250A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099475
Gene: ENSMUSG00000047126
AA Change: T1250A

DomainStartEndE-ValueType
Pfam:Clathrin_propel 19 56 2e-7 PFAM
Pfam:Clathrin_propel 148 187 3.8e-9 PFAM
Pfam:Clathrin_propel 198 234 3.8e-9 PFAM
Pfam:Clathrin-link 331 354 3.5e-17 PFAM
Pfam:Clathrin_H_link 356 421 1.9e-35 PFAM
low complexity region 445 458 N/A INTRINSIC
CLH 537 679 1.65e-41 SMART
CLH 686 828 1.24e-45 SMART
CLH 833 972 6.68e-42 SMART
CLH 979 1124 7.21e-47 SMART
CLH 1128 1269 7.91e-44 SMART
CLH 1274 1420 1.59e-48 SMART
CLH 1423 1582 8.36e-43 SMART
low complexity region 1662 1673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124385
SMART Domains Protein: ENSMUSP00000117674
Gene: ENSMUSG00000047126

DomainStartEndE-ValueType
Pfam:Clathrin 1 99 4.4e-23 PFAM
low complexity region 203 214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134999
Meta Mutation Damage Score 0.1731 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Clathrin is a major protein component of the cytoplasmic face of intracellular organelles, called coated vesicles and coated pits. These specialized organelles are involved in the intracellular trafficking of receptors and endocytosis of a variety of macromolecules. The basic subunit of the clathrin coat is composed of three heavy chains and three light chains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,115,639 (GRCm39) R575Q probably damaging Het
Arhgap22 T G 14: 33,088,650 (GRCm39) V377G probably benign Het
Asic4 T C 1: 75,427,483 (GRCm39) I3T probably damaging Het
Atp2b4 T C 1: 133,656,506 (GRCm39) T715A probably benign Het
Bltp3a T C 17: 28,103,992 (GRCm39) L464P possibly damaging Het
Ccdc180 A T 4: 45,917,508 (GRCm39) H283L probably damaging Het
Cfap91 A G 16: 38,152,683 (GRCm39) S176P probably benign Het
Cfb A G 17: 35,078,002 (GRCm39) V976A probably damaging Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,180,730 (GRCm39) D131E probably damaging Het
Dmxl1 T C 18: 50,026,651 (GRCm39) S1920P probably damaging Het
Dnajc13 G A 9: 104,108,185 (GRCm39) H197Y probably benign Het
Dpy19l1 C T 9: 24,349,924 (GRCm39) probably null Het
Ears2 A G 7: 121,643,683 (GRCm39) probably benign Het
Epgn A C 5: 91,176,136 (GRCm39) probably benign Het
Ern1 T C 11: 106,302,601 (GRCm39) T418A probably benign Het
F12 G A 13: 55,567,981 (GRCm39) P476S probably benign Het
Gal3st2c C T 1: 93,936,930 (GRCm39) Q292* probably null Het
Galnt7 C A 8: 58,037,061 (GRCm39) Q109H possibly damaging Het
Gimap1 G T 6: 48,720,032 (GRCm39) G215W probably damaging Het
Gm28042 T A 2: 119,872,082 (GRCm39) probably null Het
Gm5414 A G 15: 101,534,252 (GRCm39) I284T possibly damaging Het
Hddc3 A G 7: 79,992,914 (GRCm39) E10G probably damaging Het
Hmgxb3 T C 18: 61,305,266 (GRCm39) K31E probably damaging Het
Hspg2 A C 4: 137,246,083 (GRCm39) Y989S probably damaging Het
Kif12 G A 4: 63,086,141 (GRCm39) T402M probably benign Het
Klhdc4 A T 8: 122,540,529 (GRCm39) L115* probably null Het
Lama2 C T 10: 27,066,699 (GRCm39) V1061M possibly damaging Het
Llgl1 C T 11: 60,602,833 (GRCm39) T836I possibly damaging Het
Map4k4 A G 1: 40,025,922 (GRCm39) D304G probably damaging Het
Matn2 A G 15: 34,433,660 (GRCm39) Q915R possibly damaging Het
Myo18a A G 11: 77,755,668 (GRCm39) probably benign Het
Myorg C A 4: 41,498,407 (GRCm39) E408* probably null Het
Nbn A T 4: 15,965,132 (GRCm39) probably null Het
Nek8 G A 11: 78,061,297 (GRCm39) Q383* probably null Het
Nme7 T G 1: 164,208,245 (GRCm39) Y304* probably null Het
Nol8 A T 13: 49,814,588 (GRCm39) H214L probably benign Het
Nostrin A T 2: 69,006,098 (GRCm39) I261F possibly damaging Het
Oprk1 T G 1: 5,672,897 (GRCm39) C345G probably damaging Het
Or13a18 A G 7: 140,190,102 (GRCm39) T8A probably benign Het
Or52j3 A T 7: 102,836,710 (GRCm39) I301L probably benign Het
Polrmt T C 10: 79,573,310 (GRCm39) S998G probably benign Het
Ppp1r12c T A 7: 4,487,495 (GRCm39) R393* probably null Het
Prpf3 T A 3: 95,757,036 (GRCm39) probably benign Het
Rabl6 T C 2: 25,475,385 (GRCm39) M563V probably benign Het
Rasa2 C A 9: 96,426,844 (GRCm39) E775* probably null Het
Rc3h1 G T 1: 160,779,222 (GRCm39) V552L probably damaging Het
Rhot1 A T 11: 80,137,592 (GRCm39) N365Y possibly damaging Het
Rimbp3 G A 16: 17,027,781 (GRCm39) V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 (GRCm39) probably null Het
Slc25a11 T C 11: 70,536,643 (GRCm39) E141G probably damaging Het
Slc34a1 A T 13: 55,548,975 (GRCm39) I142F probably damaging Het
Socs6 A C 18: 88,887,504 (GRCm39) Y470* probably null Het
Sox12 A T 2: 152,239,098 (GRCm39) L174Q unknown Het
Srl A G 16: 4,314,267 (GRCm39) probably null Het
Tacc1 A T 8: 25,691,237 (GRCm39) V22E probably damaging Het
Thsd7a A T 6: 12,379,582 (GRCm39) C947* probably null Het
Tlr12 A C 4: 128,512,169 (GRCm39) V27G probably damaging Het
Tmprss4 C A 9: 45,085,260 (GRCm39) V398L probably benign Het
Trip6 T C 5: 137,310,434 (GRCm39) D270G probably damaging Het
Uba5 T G 9: 103,926,497 (GRCm39) N355T probably benign Het
Ubr5 A G 15: 38,006,761 (GRCm39) Y1171H probably benign Het
Vmn2r57 A G 7: 41,049,664 (GRCm39) I695T probably benign Het
Vmn2r68 T A 7: 84,871,199 (GRCm39) I695L probably damaging Het
Vmn2r79 T A 7: 86,651,177 (GRCm39) M192K probably damaging Het
Vps16 G T 2: 130,285,288 (GRCm39) E782* probably null Het
Zfp783 A G 6: 47,923,737 (GRCm39) noncoding transcript Het
Other mutations in Cltc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Cltc APN 11 86,593,074 (GRCm39) missense probably benign 0.43
IGL01503:Cltc APN 11 86,586,526 (GRCm39) splice site probably benign
IGL01649:Cltc APN 11 86,617,226 (GRCm39) missense probably benign 0.16
IGL01896:Cltc APN 11 86,615,959 (GRCm39) missense probably damaging 1.00
IGL02005:Cltc APN 11 86,621,045 (GRCm39) missense possibly damaging 0.86
IGL02125:Cltc APN 11 86,595,636 (GRCm39) unclassified probably benign
IGL02166:Cltc APN 11 86,594,914 (GRCm39) missense probably benign 0.00
IGL02186:Cltc APN 11 86,595,812 (GRCm39) missense possibly damaging 0.55
IGL02186:Cltc APN 11 86,595,811 (GRCm39) missense possibly damaging 0.55
IGL02214:Cltc APN 11 86,623,412 (GRCm39) missense probably benign 0.08
IGL02227:Cltc APN 11 86,588,166 (GRCm39) missense possibly damaging 0.85
IGL02471:Cltc APN 11 86,608,860 (GRCm39) missense probably damaging 1.00
IGL02607:Cltc APN 11 86,597,540 (GRCm39) missense probably benign 0.00
IGL02888:Cltc APN 11 86,648,123 (GRCm39) utr 5 prime probably benign
IGL03226:Cltc APN 11 86,611,113 (GRCm39) missense probably damaging 1.00
IGL03337:Cltc APN 11 86,594,509 (GRCm39) missense possibly damaging 0.95
Buckey UTSW 11 86,611,188 (GRCm39) missense probably benign 0.01
fuller UTSW 11 86,594,986 (GRCm39) missense possibly damaging 0.79
Geodesic UTSW 11 86,624,456 (GRCm39) missense probably damaging 0.97
R0468:Cltc UTSW 11 86,595,452 (GRCm39) unclassified probably benign
R0487:Cltc UTSW 11 86,624,490 (GRCm39) missense probably damaging 1.00
R0515:Cltc UTSW 11 86,599,865 (GRCm39) missense probably benign 0.25
R0631:Cltc UTSW 11 86,603,439 (GRCm39) missense probably benign 0.03
R0759:Cltc UTSW 11 86,627,908 (GRCm39) missense probably null 0.91
R1635:Cltc UTSW 11 86,648,105 (GRCm39) missense probably benign 0.00
R1671:Cltc UTSW 11 86,623,421 (GRCm39) missense possibly damaging 0.88
R1695:Cltc UTSW 11 86,591,886 (GRCm39) critical splice donor site probably null
R1737:Cltc UTSW 11 86,624,553 (GRCm39) missense probably damaging 1.00
R1747:Cltc UTSW 11 86,597,907 (GRCm39) missense probably damaging 1.00
R1880:Cltc UTSW 11 86,603,457 (GRCm39) missense probably damaging 1.00
R2291:Cltc UTSW 11 86,624,448 (GRCm39) missense probably benign 0.35
R3031:Cltc UTSW 11 86,621,158 (GRCm39) missense probably damaging 1.00
R4012:Cltc UTSW 11 86,648,087 (GRCm39) missense probably benign 0.12
R4022:Cltc UTSW 11 86,611,174 (GRCm39) missense probably damaging 0.96
R4394:Cltc UTSW 11 86,624,456 (GRCm39) missense probably damaging 0.97
R4654:Cltc UTSW 11 86,617,196 (GRCm39) missense probably benign 0.10
R4807:Cltc UTSW 11 86,591,902 (GRCm39) intron probably benign
R4837:Cltc UTSW 11 86,586,474 (GRCm39) missense probably benign 0.00
R4965:Cltc UTSW 11 86,598,327 (GRCm39) missense probably damaging 0.99
R5072:Cltc UTSW 11 86,608,794 (GRCm39) missense possibly damaging 0.86
R5113:Cltc UTSW 11 86,613,147 (GRCm39) missense probably damaging 0.98
R5126:Cltc UTSW 11 86,603,495 (GRCm39) missense probably damaging 1.00
R5609:Cltc UTSW 11 86,621,093 (GRCm39) missense probably damaging 0.99
R5610:Cltc UTSW 11 86,612,472 (GRCm39) missense probably benign 0.00
R5677:Cltc UTSW 11 86,596,068 (GRCm39) missense probably damaging 1.00
R5999:Cltc UTSW 11 86,594,955 (GRCm39) missense possibly damaging 0.93
R6197:Cltc UTSW 11 86,611,188 (GRCm39) missense probably benign 0.01
R6198:Cltc UTSW 11 86,611,188 (GRCm39) missense probably benign 0.01
R6264:Cltc UTSW 11 86,596,084 (GRCm39) missense probably damaging 1.00
R6395:Cltc UTSW 11 86,616,006 (GRCm39) missense probably damaging 0.97
R6818:Cltc UTSW 11 86,595,054 (GRCm39) missense possibly damaging 0.86
R6894:Cltc UTSW 11 86,603,428 (GRCm39) nonsense probably null
R7196:Cltc UTSW 11 86,597,657 (GRCm39) missense probably damaging 1.00
R7438:Cltc UTSW 11 86,616,054 (GRCm39) missense probably benign 0.01
R7621:Cltc UTSW 11 86,598,312 (GRCm39) missense probably benign 0.03
R7637:Cltc UTSW 11 86,621,158 (GRCm39) missense probably damaging 1.00
R7729:Cltc UTSW 11 86,612,474 (GRCm39) missense probably benign
R7769:Cltc UTSW 11 86,610,319 (GRCm39) missense probably damaging 1.00
R7817:Cltc UTSW 11 86,615,949 (GRCm39) missense probably damaging 1.00
R7944:Cltc UTSW 11 86,627,967 (GRCm39) missense probably benign 0.01
R7945:Cltc UTSW 11 86,627,967 (GRCm39) missense probably benign 0.01
R8040:Cltc UTSW 11 86,616,031 (GRCm39) missense probably damaging 1.00
R8105:Cltc UTSW 11 86,598,438 (GRCm39) missense probably damaging 0.98
R8203:Cltc UTSW 11 86,594,986 (GRCm39) missense possibly damaging 0.79
R8297:Cltc UTSW 11 86,603,457 (GRCm39) missense probably damaging 1.00
R8304:Cltc UTSW 11 86,616,087 (GRCm39) missense probably benign 0.01
R8419:Cltc UTSW 11 86,598,392 (GRCm39) missense probably benign 0.01
R8673:Cltc UTSW 11 86,648,201 (GRCm39) start gained probably benign
R8940:Cltc UTSW 11 86,621,072 (GRCm39) missense probably benign 0.30
R8958:Cltc UTSW 11 86,586,403 (GRCm39) missense possibly damaging 0.86
R9182:Cltc UTSW 11 86,595,982 (GRCm39) missense probably damaging 1.00
R9188:Cltc UTSW 11 86,627,992 (GRCm39) missense probably damaging 0.98
R9293:Cltc UTSW 11 86,603,446 (GRCm39) missense possibly damaging 0.47
R9456:Cltc UTSW 11 86,593,237 (GRCm39) missense probably benign 0.38
R9559:Cltc UTSW 11 86,613,086 (GRCm39) missense probably damaging 1.00
R9576:Cltc UTSW 11 86,593,237 (GRCm39) missense probably benign 0.38
R9578:Cltc UTSW 11 86,593,237 (GRCm39) missense probably benign 0.38
Z1176:Cltc UTSW 11 86,593,458 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAACTCTTTCCCATCTACACAGG -3'
(R):5'- GGGATTAGGCTGAAACCTGTG -3'

Sequencing Primer
(F):5'- TCTTTCCCATCTACACAGGCAAAG -3'
(R):5'- AGGCTGAAACCTGTGTTTTACTGATC -3'
Posted On 2016-07-06