Incidental Mutation 'R5177:Nol8'
ID 399635
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Name nucleolar protein 8
Synonyms D13Ertd548e, 4921532D18Rik, 5730412B09Rik
MMRRC Submission 042757-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5177 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 49806554-49832492 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 49814588 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 214 (H214L)
Ref Sequence ENSEMBL: ENSMUSP00000152878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467]
AlphaFold Q3UHX0
Predicted Effect probably benign
Transcript: ENSMUST00000021824
AA Change: H232L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: H232L

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221083
AA Change: H214L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221142
AA Change: H214L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000222197
AA Change: H232L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000222333
Predicted Effect probably benign
Transcript: ENSMUST00000223264
Predicted Effect probably benign
Transcript: ENSMUST00000223467
AA Change: H214L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,115,639 (GRCm39) R575Q probably damaging Het
Arhgap22 T G 14: 33,088,650 (GRCm39) V377G probably benign Het
Asic4 T C 1: 75,427,483 (GRCm39) I3T probably damaging Het
Atp2b4 T C 1: 133,656,506 (GRCm39) T715A probably benign Het
Bltp3a T C 17: 28,103,992 (GRCm39) L464P possibly damaging Het
Ccdc180 A T 4: 45,917,508 (GRCm39) H283L probably damaging Het
Cfap91 A G 16: 38,152,683 (GRCm39) S176P probably benign Het
Cfb A G 17: 35,078,002 (GRCm39) V976A probably damaging Het
Cltc T C 11: 86,595,989 (GRCm39) T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,180,730 (GRCm39) D131E probably damaging Het
Dmxl1 T C 18: 50,026,651 (GRCm39) S1920P probably damaging Het
Dnajc13 G A 9: 104,108,185 (GRCm39) H197Y probably benign Het
Dpy19l1 C T 9: 24,349,924 (GRCm39) probably null Het
Ears2 A G 7: 121,643,683 (GRCm39) probably benign Het
Epgn A C 5: 91,176,136 (GRCm39) probably benign Het
Ern1 T C 11: 106,302,601 (GRCm39) T418A probably benign Het
F12 G A 13: 55,567,981 (GRCm39) P476S probably benign Het
Gal3st2c C T 1: 93,936,930 (GRCm39) Q292* probably null Het
Galnt7 C A 8: 58,037,061 (GRCm39) Q109H possibly damaging Het
Gimap1 G T 6: 48,720,032 (GRCm39) G215W probably damaging Het
Gm28042 T A 2: 119,872,082 (GRCm39) probably null Het
Gm5414 A G 15: 101,534,252 (GRCm39) I284T possibly damaging Het
Hddc3 A G 7: 79,992,914 (GRCm39) E10G probably damaging Het
Hmgxb3 T C 18: 61,305,266 (GRCm39) K31E probably damaging Het
Hspg2 A C 4: 137,246,083 (GRCm39) Y989S probably damaging Het
Kif12 G A 4: 63,086,141 (GRCm39) T402M probably benign Het
Klhdc4 A T 8: 122,540,529 (GRCm39) L115* probably null Het
Lama2 C T 10: 27,066,699 (GRCm39) V1061M possibly damaging Het
Llgl1 C T 11: 60,602,833 (GRCm39) T836I possibly damaging Het
Map4k4 A G 1: 40,025,922 (GRCm39) D304G probably damaging Het
Matn2 A G 15: 34,433,660 (GRCm39) Q915R possibly damaging Het
Myo18a A G 11: 77,755,668 (GRCm39) probably benign Het
Myorg C A 4: 41,498,407 (GRCm39) E408* probably null Het
Nbn A T 4: 15,965,132 (GRCm39) probably null Het
Nek8 G A 11: 78,061,297 (GRCm39) Q383* probably null Het
Nme7 T G 1: 164,208,245 (GRCm39) Y304* probably null Het
Nostrin A T 2: 69,006,098 (GRCm39) I261F possibly damaging Het
Oprk1 T G 1: 5,672,897 (GRCm39) C345G probably damaging Het
Or13a18 A G 7: 140,190,102 (GRCm39) T8A probably benign Het
Or52j3 A T 7: 102,836,710 (GRCm39) I301L probably benign Het
Polrmt T C 10: 79,573,310 (GRCm39) S998G probably benign Het
Ppp1r12c T A 7: 4,487,495 (GRCm39) R393* probably null Het
Prpf3 T A 3: 95,757,036 (GRCm39) probably benign Het
Rabl6 T C 2: 25,475,385 (GRCm39) M563V probably benign Het
Rasa2 C A 9: 96,426,844 (GRCm39) E775* probably null Het
Rc3h1 G T 1: 160,779,222 (GRCm39) V552L probably damaging Het
Rhot1 A T 11: 80,137,592 (GRCm39) N365Y possibly damaging Het
Rimbp3 G A 16: 17,027,781 (GRCm39) V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 (GRCm39) probably null Het
Slc25a11 T C 11: 70,536,643 (GRCm39) E141G probably damaging Het
Slc34a1 A T 13: 55,548,975 (GRCm39) I142F probably damaging Het
Socs6 A C 18: 88,887,504 (GRCm39) Y470* probably null Het
Sox12 A T 2: 152,239,098 (GRCm39) L174Q unknown Het
Srl A G 16: 4,314,267 (GRCm39) probably null Het
Tacc1 A T 8: 25,691,237 (GRCm39) V22E probably damaging Het
Thsd7a A T 6: 12,379,582 (GRCm39) C947* probably null Het
Tlr12 A C 4: 128,512,169 (GRCm39) V27G probably damaging Het
Tmprss4 C A 9: 45,085,260 (GRCm39) V398L probably benign Het
Trip6 T C 5: 137,310,434 (GRCm39) D270G probably damaging Het
Uba5 T G 9: 103,926,497 (GRCm39) N355T probably benign Het
Ubr5 A G 15: 38,006,761 (GRCm39) Y1171H probably benign Het
Vmn2r57 A G 7: 41,049,664 (GRCm39) I695T probably benign Het
Vmn2r68 T A 7: 84,871,199 (GRCm39) I695L probably damaging Het
Vmn2r79 T A 7: 86,651,177 (GRCm39) M192K probably damaging Het
Vps16 G T 2: 130,285,288 (GRCm39) E782* probably null Het
Zfp783 A G 6: 47,923,737 (GRCm39) noncoding transcript Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49,815,704 (GRCm39) missense probably benign 0.01
IGL01106:Nol8 APN 13 49,807,957 (GRCm39) missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49,813,428 (GRCm39) missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49,815,146 (GRCm39) missense probably benign 0.06
IGL01670:Nol8 APN 13 49,814,784 (GRCm39) missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49,828,883 (GRCm39) missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49,826,248 (GRCm39) missense probably benign
IGL02212:Nol8 APN 13 49,815,626 (GRCm39) missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49,808,721 (GRCm39) splice site probably benign
IGL02645:Nol8 APN 13 49,818,947 (GRCm39) critical splice donor site probably null
IGL02949:Nol8 APN 13 49,815,878 (GRCm39) missense probably benign 0.01
IGL02954:Nol8 APN 13 49,814,648 (GRCm39) missense probably benign 0.01
IGL03182:Nol8 APN 13 49,817,557 (GRCm39) missense probably damaging 1.00
IGL03406:Nol8 APN 13 49,815,044 (GRCm39) missense probably damaging 1.00
P0047:Nol8 UTSW 13 49,807,824 (GRCm39) splice site probably null
R0092:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49,826,165 (GRCm39) missense probably benign
R0145:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49,807,921 (GRCm39) missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49,815,628 (GRCm39) missense probably damaging 1.00
R0617:Nol8 UTSW 13 49,807,921 (GRCm39) missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49,830,234 (GRCm39) missense probably benign 0.05
R0637:Nol8 UTSW 13 49,815,923 (GRCm39) missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49,830,245 (GRCm39) missense probably damaging 1.00
R1446:Nol8 UTSW 13 49,808,703 (GRCm39) missense probably damaging 1.00
R1464:Nol8 UTSW 13 49,830,264 (GRCm39) missense probably benign
R1464:Nol8 UTSW 13 49,830,264 (GRCm39) missense probably benign
R1627:Nol8 UTSW 13 49,814,980 (GRCm39) missense probably benign 0.01
R1703:Nol8 UTSW 13 49,820,933 (GRCm39) missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49,820,884 (GRCm39) missense probably benign 0.06
R2187:Nol8 UTSW 13 49,815,475 (GRCm39) missense probably benign 0.00
R2357:Nol8 UTSW 13 49,807,980 (GRCm39) critical splice donor site probably null
R3081:Nol8 UTSW 13 49,831,868 (GRCm39) unclassified probably benign
R3969:Nol8 UTSW 13 49,813,492 (GRCm39) nonsense probably null
R4199:Nol8 UTSW 13 49,815,224 (GRCm39) missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49,816,229 (GRCm39) missense probably damaging 1.00
R4927:Nol8 UTSW 13 49,807,901 (GRCm39) missense possibly damaging 0.79
R5512:Nol8 UTSW 13 49,830,263 (GRCm39) missense probably benign
R5744:Nol8 UTSW 13 49,815,802 (GRCm39) missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49,826,090 (GRCm39) missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49,807,160 (GRCm39) critical splice donor site probably null
R6306:Nol8 UTSW 13 49,829,829 (GRCm39) missense probably damaging 1.00
R6359:Nol8 UTSW 13 49,817,546 (GRCm39) missense probably benign 0.16
R6378:Nol8 UTSW 13 49,820,831 (GRCm39) missense probably damaging 1.00
R6655:Nol8 UTSW 13 49,807,868 (GRCm39) missense probably damaging 1.00
R7035:Nol8 UTSW 13 49,814,678 (GRCm39) missense probably benign 0.06
R7058:Nol8 UTSW 13 49,829,862 (GRCm39) missense probably damaging 1.00
R7368:Nol8 UTSW 13 49,814,695 (GRCm39) missense probably benign 0.00
R7450:Nol8 UTSW 13 49,813,491 (GRCm39) missense probably benign 0.01
R7673:Nol8 UTSW 13 49,818,256 (GRCm39) missense probably benign 0.15
R7750:Nol8 UTSW 13 49,815,742 (GRCm39) missense possibly damaging 0.83
R8246:Nol8 UTSW 13 49,808,724 (GRCm39) splice site probably benign
R9081:Nol8 UTSW 13 49,814,881 (GRCm39) missense probably benign 0.00
R9127:Nol8 UTSW 13 49,815,475 (GRCm39) missense probably benign 0.00
R9223:Nol8 UTSW 13 49,814,738 (GRCm39) missense possibly damaging 0.63
X0020:Nol8 UTSW 13 49,814,641 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTTCCCTAACACCTGCTG -3'
(R):5'- ACATGTTTAGGTTTCTGAGTACCAG -3'

Sequencing Primer
(F):5'- AACACCTGCTGCTCTTGC -3'
(R):5'- ACTGGACACAAGGAGTTGTTTAG -3'
Posted On 2016-07-06