Incidental Mutation 'R5177:Nol8'
ID399635
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Namenucleolar protein 8
Synonyms5730412B09Rik, D13Ertd548e, 4921532D18Rik
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location49653078-49679016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49661112 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 214 (H214L)
Ref Sequence ENSEMBL: ENSMUSP00000152878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467]
Predicted Effect probably benign
Transcript: ENSMUST00000021824
AA Change: H232L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: H232L

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221083
AA Change: H214L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221142
AA Change: H214L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000222197
AA Change: H232L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000222333
Predicted Effect probably benign
Transcript: ENSMUST00000223264
Predicted Effect probably benign
Transcript: ENSMUST00000223467
AA Change: H214L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0860 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
F12 G A 13: 55,420,168 P476S probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49662228 missense probably benign 0.01
IGL01106:Nol8 APN 13 49654481 missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49659952 missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49661670 missense probably benign 0.06
IGL01670:Nol8 APN 13 49661308 missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49675407 missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49672772 missense probably benign
IGL02212:Nol8 APN 13 49662150 missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49655245 splice site probably benign
IGL02645:Nol8 APN 13 49665471 critical splice donor site probably null
IGL02949:Nol8 APN 13 49662402 missense probably benign 0.01
IGL02954:Nol8 APN 13 49661172 missense probably benign 0.01
IGL03182:Nol8 APN 13 49664081 missense probably damaging 1.00
IGL03406:Nol8 APN 13 49661568 missense probably damaging 1.00
P0047:Nol8 UTSW 13 49654348 splice site probably null
R0092:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49672689 missense probably benign
R0145:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49662152 missense probably damaging 1.00
R0617:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49676758 missense probably benign 0.05
R0637:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49676769 missense probably damaging 1.00
R1446:Nol8 UTSW 13 49655227 missense probably damaging 1.00
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1627:Nol8 UTSW 13 49661504 missense probably benign 0.01
R1703:Nol8 UTSW 13 49667457 missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49667408 missense probably benign 0.06
R2187:Nol8 UTSW 13 49661999 missense probably benign 0.00
R2357:Nol8 UTSW 13 49654504 critical splice donor site probably null
R3081:Nol8 UTSW 13 49678392 unclassified probably benign
R3969:Nol8 UTSW 13 49660016 nonsense probably null
R4199:Nol8 UTSW 13 49661748 missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49662753 missense probably damaging 1.00
R4927:Nol8 UTSW 13 49654425 missense possibly damaging 0.79
R5512:Nol8 UTSW 13 49676787 missense probably benign
R5744:Nol8 UTSW 13 49662326 missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49672614 missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49653684 critical splice donor site probably null
R6306:Nol8 UTSW 13 49676353 missense probably damaging 1.00
R6359:Nol8 UTSW 13 49664070 missense probably benign 0.16
R6378:Nol8 UTSW 13 49667355 missense probably damaging 1.00
R6655:Nol8 UTSW 13 49654392 missense probably damaging 1.00
R7035:Nol8 UTSW 13 49661202 missense probably benign 0.06
R7058:Nol8 UTSW 13 49676386 missense probably damaging 1.00
R7368:Nol8 UTSW 13 49661219 missense probably benign 0.00
R7450:Nol8 UTSW 13 49660015 missense probably benign 0.01
R7673:Nol8 UTSW 13 49664780 missense probably benign 0.15
R7750:Nol8 UTSW 13 49662266 missense possibly damaging 0.83
X0020:Nol8 UTSW 13 49661165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGTTTCCCTAACACCTGCTG -3'
(R):5'- ACATGTTTAGGTTTCTGAGTACCAG -3'

Sequencing Primer
(F):5'- AACACCTGCTGCTCTTGC -3'
(R):5'- ACTGGACACAAGGAGTTGTTTAG -3'
Posted On2016-07-06