Incidental Mutation 'R5177:F12'
ID399639
Institutional Source Beutler Lab
Gene Symbol F12
Ensembl Gene ENSMUSG00000021492
Gene Namecoagulation factor XII (Hageman factor)
SynonymsFXII
MMRRC Submission 042757-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R5177 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55417958-55426793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55420168 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 476 (P476S)
Ref Sequence ENSEMBL: ENSMUSP00000021948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021948] [ENSMUST00000054146] [ENSMUST00000170921] [ENSMUST00000225259]
Predicted Effect probably benign
Transcript: ENSMUST00000021948
AA Change: P476S

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000021948
Gene: ENSMUSG00000021492
AA Change: P476S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN2 40 88 4.3e-24 SMART
EGF 97 131 4.22e-4 SMART
FN1 135 175 2.4e-13 SMART
EGF 177 210 3.94e-4 SMART
KR 215 297 6.88e-27 SMART
low complexity region 302 320 N/A INTRINSIC
Tryp_SPc 354 591 7.74e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054146
SMART Domains Protein: ENSMUSP00000054053
Gene: ENSMUSG00000044444

DomainStartEndE-ValueType
Pfam:Profilin 3 132 7.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170921
SMART Domains Protein: ENSMUSP00000125771
Gene: ENSMUSG00000021492

DomainStartEndE-ValueType
Tryp_SPc 2 137 3.4e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225259
Meta Mutation Damage Score 0.1372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a glycoprotein coagulation factor that plays an important role in the intrinsic pathway of blood coagulation and hemostasis. The encoded protein is an inactive zymogen that is autoactivated upon contact with negatively charged surfaces or misfolded protein aggregates. Mice lacking the encoded protein have a severe defect in forming stable fibrin clots. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are protected from ischemic brain injury in an experimental stroke model, without exhibiting an increase in infarct-associated hemorrhage. Another null mouse shows decreased plasma bradykinin levels and prolonged activated partial thromboplastin times. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 C T 2: 69,285,295 R575Q probably damaging Het
AI464131 C A 4: 41,498,407 E408* probably null Het
Arhgap22 T G 14: 33,366,693 V377G probably benign Het
Asic4 T C 1: 75,450,839 I3T probably damaging Het
Atp2b4 T C 1: 133,728,768 T715A probably benign Het
Ccdc180 A T 4: 45,917,508 H283L probably damaging Het
Cfb A G 17: 34,859,026 V976A probably damaging Het
Cltc T C 11: 86,705,163 T1250A probably damaging Het
Cylc2 T C 4: 51,228,587 probably benign Het
Dcbld1 T A 10: 52,304,634 D131E probably damaging Het
Dmxl1 T C 18: 49,893,584 S1920P probably damaging Het
Dnajc13 G A 9: 104,230,986 H197Y probably benign Het
Dpy19l1 C T 9: 24,438,628 probably null Het
Ears2 A G 7: 122,044,460 probably benign Het
Epgn A C 5: 91,028,277 probably benign Het
Ern1 T C 11: 106,411,775 T418A probably benign Het
Gal3st2c C T 1: 94,009,208 Q292* probably null Het
Galnt7 C A 8: 57,584,027 Q109H possibly damaging Het
Gimap1 G T 6: 48,743,098 G215W probably damaging Het
Gm28042 T A 2: 120,041,601 probably null Het
Gm5414 A G 15: 101,625,817 I284T possibly damaging Het
Hddc3 A G 7: 80,343,166 E10G probably damaging Het
Hmgxb3 T C 18: 61,172,194 K31E probably damaging Het
Hspg2 A C 4: 137,518,772 Y989S probably damaging Het
Kif12 G A 4: 63,167,904 T402M probably benign Het
Klhdc4 A T 8: 121,813,790 L115* probably null Het
Lama2 C T 10: 27,190,703 V1061M possibly damaging Het
Llgl1 C T 11: 60,712,007 T836I possibly damaging Het
Maats1 A G 16: 38,332,321 S176P probably benign Het
Map4k4 A G 1: 39,986,762 D304G probably damaging Het
Matn2 A G 15: 34,433,514 Q915R possibly damaging Het
Myo18a A G 11: 77,864,842 probably benign Het
Nbn A T 4: 15,965,132 probably null Het
Nek8 G A 11: 78,170,471 Q383* probably null Het
Nme7 T G 1: 164,380,676 Y304* probably null Het
Nol8 A T 13: 49,661,112 H214L probably benign Het
Nostrin A T 2: 69,175,754 I261F possibly damaging Het
Olfr46 A G 7: 140,610,189 T8A probably benign Het
Olfr592 A T 7: 103,187,503 I301L probably benign Het
Oprk1 T G 1: 5,602,674 C345G probably damaging Het
Polrmt T C 10: 79,737,476 S998G probably benign Het
Ppp1r12c T A 7: 4,484,496 R393* probably null Het
Prpf3 T A 3: 95,849,724 probably benign Het
Rabl6 T C 2: 25,585,373 M563V probably benign Het
Rasa2 C A 9: 96,544,791 E775* probably null Het
Rc3h1 G T 1: 160,951,652 V552L probably damaging Het
Rhot1 A T 11: 80,246,766 N365Y possibly damaging Het
Rimbp3 G A 16: 17,209,917 V402M possibly damaging Het
Rusc2 A T 4: 43,421,805 probably null Het
Slc25a11 T C 11: 70,645,817 E141G probably damaging Het
Slc34a1 A T 13: 55,401,162 I142F probably damaging Het
Socs6 A C 18: 88,869,380 Y470* probably null Het
Sox12 A T 2: 152,397,178 L174Q unknown Het
Srl A G 16: 4,496,403 probably null Het
Tacc1 A T 8: 25,201,221 V22E probably damaging Het
Thsd7a A T 6: 12,379,583 C947* probably null Het
Tlr12 A C 4: 128,618,376 V27G probably damaging Het
Tmprss4 C A 9: 45,173,962 V398L probably benign Het
Trip6 T C 5: 137,312,172 D270G probably damaging Het
Uba5 T G 9: 104,049,298 N355T probably benign Het
Ubr5 A G 15: 38,006,517 Y1171H probably benign Het
Uhrf1bp1 T C 17: 27,885,018 L464P possibly damaging Het
Vmn2r57 A G 7: 41,400,240 I695T probably benign Het
Vmn2r68 T A 7: 85,221,991 I695L probably damaging Het
Vmn2r79 T A 7: 87,001,969 M192K probably damaging Het
Vps16 G T 2: 130,443,368 E782* probably null Het
Zfp783 A G 6: 47,946,803 noncoding transcript Het
Other mutations in F12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:F12 APN 13 55426344 missense possibly damaging 0.83
IGL02756:F12 APN 13 55421067 missense possibly damaging 0.58
IGL03030:F12 APN 13 55421519 intron probably benign
R0049:F12 UTSW 13 55426317 missense probably benign 0.00
R0049:F12 UTSW 13 55426317 missense probably benign 0.00
R0646:F12 UTSW 13 55422483 intron probably benign
R1670:F12 UTSW 13 55421533 missense probably damaging 1.00
R1896:F12 UTSW 13 55420727 missense probably damaging 1.00
R3508:F12 UTSW 13 55421059 missense probably benign
R3548:F12 UTSW 13 55418137 missense probably benign 0.03
R3856:F12 UTSW 13 55421222 intron probably null
R4583:F12 UTSW 13 55421130 missense probably benign 0.04
R5369:F12 UTSW 13 55418491 missense probably benign 0.13
R5529:F12 UTSW 13 55422059 missense probably benign 0.04
R5637:F12 UTSW 13 55422415 missense possibly damaging 0.57
R6812:F12 UTSW 13 55421845 missense probably damaging 0.97
R7156:F12 UTSW 13 55418497 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGGGAAAGTCACGCTAC -3'
(R):5'- TCACCTACCAGCACGACTTG -3'

Sequencing Primer
(F):5'- CGCTACAGAGACAAGGGCTCTG -3'
(R):5'- TACCAGCACGACTTGGGTGG -3'
Posted On2016-07-06