Incidental Mutation 'R0455:Ppm1h'
ID39966
Institutional Source Beutler Lab
Gene Symbol Ppm1h
Ensembl Gene ENSMUSG00000034613
Gene Nameprotein phosphatase 1H (PP2C domain containing)
SynonymsARHCL1, A430075L18Rik, C030002B11Rik
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R0455 (G1)
Quality Score157
Status Validated
Chromosome10
Chromosomal Location122678762-122945795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 122802324 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 166 (Q166H)
Ref Sequence ENSEMBL: ENSMUSP00000124982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067918] [ENSMUST00000161487]
Predicted Effect probably benign
Transcript: ENSMUST00000067918
AA Change: Q166H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066561
Gene: ENSMUSG00000034613
AA Change: Q166H

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
PP2Cc 67 504 1.22e-35 SMART
PP2C_SIG 136 506 1.59e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160315
Predicted Effect probably benign
Transcript: ENSMUST00000161487
AA Change: Q166H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124982
Gene: ENSMUSG00000034613
AA Change: Q166H

DomainStartEndE-ValueType
low complexity region 19 33 N/A INTRINSIC
PP2Cc 67 455 6.36e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162853
Meta Mutation Damage Score 0.0778 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Ppm1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Ppm1h APN 10 122878629 critical splice donor site probably null
IGL01060:Ppm1h APN 10 122907571 missense possibly damaging 0.49
IGL01557:Ppm1h APN 10 122782181 critical splice acceptor site probably null
IGL01608:Ppm1h APN 10 122941280 nonsense probably null
IGL02112:Ppm1h APN 10 122802400 missense possibly damaging 0.86
R0129:Ppm1h UTSW 10 122941355 missense probably damaging 0.97
R0217:Ppm1h UTSW 10 122920735 missense probably damaging 1.00
R0309:Ppm1h UTSW 10 122920782 missense probably damaging 1.00
R1144:Ppm1h UTSW 10 122941278 missense probably benign 0.01
R1430:Ppm1h UTSW 10 122857099 missense probably damaging 1.00
R2014:Ppm1h UTSW 10 122920725 missense possibly damaging 0.79
R2021:Ppm1h UTSW 10 122878528 nonsense probably null
R2882:Ppm1h UTSW 10 122941334 missense probably damaging 0.99
R3767:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R3768:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R3770:Ppm1h UTSW 10 122904122 missense probably damaging 1.00
R4816:Ppm1h UTSW 10 122679379 missense possibly damaging 0.89
R4996:Ppm1h UTSW 10 122941340 missense probably damaging 1.00
R5640:Ppm1h UTSW 10 122782278 missense probably benign 0.30
R6199:Ppm1h UTSW 10 122920739 missense probably damaging 1.00
R7759:Ppm1h UTSW 10 122904113 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCCGTATCAGCAGTGACTACCC -3'
(R):5'- GAAGTTTTGGCGCGAGCTACATC -3'

Sequencing Primer
(F):5'- CCCATGATTTTTAGACAGGAAACAG -3'
(R):5'- GCGCGAGCTACATCAATGG -3'
Posted On2013-05-23