Mutagenetix > Incidental Mutation

Incidental Mutation 'R5256:Cfap54'

399680

Institutional Source

Beutler Lab

Gene Symbol

Cfap54

Ensembl Gene

ENSMUSG00000020014

Gene Name

cilia and flagella associated protein 54

Synonyms

LOC380653, Gm872, 4930485B16Rik

MMRRC Submission

042827-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.095) question?

Stock #

R5256 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

92775619-93081618 bp(-) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

T to C at 93045023 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020200] [ENSMUST00000020200] [ENSMUST00000168110] [ENSMUST00000168110] [ENSMUST00000168617] [ENSMUST00000168617] [ENSMUST00000212902] [ENSMUST00000212902]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000020200

SMART Domains

Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	643	3e-298	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000020200

SMART Domains

Protein: ENSMUSP00000020200
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	643	3e-298	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000168110

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168110

SMART Domains

Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	104	642	1.1e-269	PFAM
low complexity region	842	851	N/A	INTRINSIC
low complexity region	902	915	N/A	INTRINSIC
Blast:FN3	916	1002	4e-48	BLAST
low complexity region	1409	1426	N/A	INTRINSIC
low complexity region	1974	1984	N/A	INTRINSIC
low complexity region	2354	2370	N/A	INTRINSIC
low complexity region	2500	2513	N/A	INTRINSIC
low complexity region	2605	2616	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000168617

SMART Domains

Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	148	4.3e-22	PFAM
Pfam:DUF4486	145	595	1.6e-244	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000168617

SMART Domains

Protein: ENSMUSP00000127905
Gene: ENSMUSG00000020014

Domain	Start	End	E-Value	Type
low complexity region	3	37	N/A	INTRINSIC
low complexity region	39	48	N/A	INTRINSIC
Pfam:DUF4486	103	148	4.3e-22	PFAM
Pfam:DUF4486	145	595	1.6e-244	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000212902

Predicted Effect

probably null
Transcript: ENSMUST00000212902

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.8%

Validation Efficiency

97% (95/98)

MGI Phenotype

PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730015C16Rik	C	A	4: 108,848,065		probably benign	Het
Actr1b	T	C	1: 36,700,092	H372R	probably benign	Het
Ampd2	C	A	3: 108,079,549		probably benign	Het
Anapc4	A	G	5: 52,863,594	S612G	probably benign	Het
Arhgef7	T	C	8: 11,800,811	L141P	probably damaging	Het
Atl1	A	G	12: 69,959,333	D471G	probably damaging	Het
Atrn	A	G	2: 130,946,019	D247G	probably benign	Het
Bag1	T	A	4: 40,948,022	R61W	probably damaging	Het
Card10	C	T	15: 78,778,251	R898H	probably damaging	Het
Cct6b	G	A	11: 82,764,220	A3V	probably damaging	Het
Chd5	T	C	4: 152,372,097	F964L	probably benign	Het
Cog5	A	G	12: 31,886,205	T584A	probably benign	Het
Cpa2	T	A	6: 30,547,197	N157K	probably damaging	Het
Cpeb1	A	T	7: 81,351,839	M440K	probably damaging	Het
Cracr2a	G	A	6: 127,604,029	C56Y	probably damaging	Het
Ddb2	A	C	2: 91,236,728	L30R	probably damaging	Het
Dlk1	T	A	12: 109,459,771	I190N	probably damaging	Het
Dnajc13	T	A	9: 104,203,329	Y851F	possibly damaging	Het
Dopey1	T	A	9: 86,515,328	L895Q	probably damaging	Het
Dyx1c1	T	C	9: 72,972,080		probably null	Het
F7	G	A	8: 13,030,763	C122Y	probably damaging	Het
Frrs1	T	C	3: 116,903,100	V573A	possibly damaging	Het
Gm17541	A	T	12: 4,689,672		probably benign	Het
Gm20388	T	C	8: 122,270,436		probably benign	Het
Gm5519	A	T	19: 33,823,176	H90L	probably damaging	Het
Gm5526	T	A	1: 45,857,409		noncoding transcript	Het
Gm5709	A	T	3: 59,602,550		noncoding transcript	Het
Golga4	T	A	9: 118,556,501	V869D	possibly damaging	Het
Grm7	A	T	6: 111,358,221	Q531L	probably benign	Het
Hnrnpu	C	A	1: 178,335,893	C265F	unknown	Het
Hoxd3	G	A	2: 74,746,867	V364I	possibly damaging	Het
Hspb8	T	C	5: 116,409,473	D150G	probably damaging	Het
Hydin	C	A	8: 110,587,223	N4244K	possibly damaging	Het
Ik	A	G	18: 36,748,873	D136G	probably benign	Het
Il11ra1	T	C	4: 41,767,932		probably benign	Het
Jph1	T	C	1: 17,091,398	I347V	probably benign	Het
Klk1	T	A	7: 44,221,561		probably benign	Het
Lmcd1	T	A	6: 112,288,126		probably benign	Het
Lnx1	C	T	5: 74,685,654	C45Y	probably damaging	Het
Macc1	T	A	12: 119,446,529	M344K	possibly damaging	Het
Madcam1	A	G	10: 79,664,945	E32G	possibly damaging	Het
Mat2a	T	C	6: 72,434,333	D383G	probably benign	Het
Mpst	T	A	15: 78,413,649	I289N	probably damaging	Het
Myh6	C	T	14: 54,952,661	R1055Q	probably damaging	Het
Myh7	T	C	14: 54,979,508	K1131E	probably damaging	Het
Ndrg3	A	T	2: 156,931,205		probably benign	Het
Nebl	A	G	2: 17,433,975	S209P	probably benign	Het
Nid2	A	G	14: 19,768,208		probably null	Het
Nup188	A	T	2: 30,330,749	S945C	probably damaging	Het
Olfr1000	C	T	2: 85,608,473	V146I	probably benign	Het
Olfr251	A	G	9: 38,377,917	N12S	probably benign	Het
Olfr50	A	G	2: 36,793,673	M146V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Patl2	A	G	2: 122,128,887	L32P	probably damaging	Het
Pcdh20	T	A	14: 88,468,377	M496L	probably benign	Het
Pdzd2	A	G	15: 12,372,942	V2369A	possibly damaging	Het
Pfn2	A	G	3: 57,847,391	V31A	probably damaging	Het
Plxna4	T	C	6: 32,251,072	N533S	probably benign	Het
Plxnb1	T	C	9: 109,114,593	F1916S	probably damaging	Het
Ppp4r3b	T	C	11: 29,188,293	F214L	probably benign	Het
Prox1	T	C	1: 190,161,441	D269G	probably benign	Het
Rapgef4	T	C	2: 72,034,034	F71S	probably damaging	Het
Rft1	A	G	14: 30,661,286	I94M	probably benign	Het
S100z	T	C	13: 95,478,619	I13V	probably damaging	Het
Serhl	T	A	15: 83,102,634	V117E	probably damaging	Het
Shroom1	G	A	11: 53,465,507	R336Q	probably benign	Het
Sik3	A	T	9: 46,212,254	Q1067L	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc28a1	G	A	7: 81,122,121	V118M	probably damaging	Het
Slco1a6	T	A	6: 142,132,701	I153F	probably benign	Het
Ss18l1	T	C	2: 180,061,942	Y323H	unknown	Het
Susd4	G	T	1: 182,892,259	A480S	possibly damaging	Het
Syne3	A	T	12: 104,975,880	M1K	probably null	Het
Synpo2l	A	T	14: 20,661,014	S513T	probably benign	Het
Tat	A	T	8: 109,998,334	N388I	probably benign	Het
Tbc1d1	A	G	5: 64,282,009	Y619C	probably damaging	Het
Tbk1	G	A	10: 121,570,685	T216M	probably damaging	Het
Tns1	C	T	1: 73,995,426		probably benign	Het
Trbv5	T	C	6: 41,062,384	V9A	possibly damaging	Het
Trpm5	A	G	7: 143,082,303	Y575H	probably damaging	Het
Ttn	A	T	2: 76,739,701	Y25203*	probably null	Het
Tubb3	C	A	8: 123,421,652	D441E	probably benign	Het
Usp33	T	A	3: 152,391,696	C850*	probably null	Het
Vdac1	G	A	11: 52,384,078		probably null	Het
Vmn1r232	T	C	17: 20,913,584	I251M	probably damaging	Het
Vmn2r11	T	G	5: 109,054,792	I140L	probably benign	Het
Vmn2r6	A	T	3: 64,556,842	N190K	probably benign	Het
Vps51	T	A	19: 6,070,488	H465L	probably benign	Het
Zfp318	T	G	17: 46,412,069	I1666S	probably benign	Het
Zfp446	C	T	7: 12,979,304	R90*	probably null	Het
Zgrf1	T	A	3: 127,602,445	F547I	probably damaging	Het

Other mutations in Cfap54

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cfap54	APN	10	93081523	missense	unknown
IGL02034:Cfap54	APN	10	93061485	missense	probably damaging	0.99
IGL02082:Cfap54	APN	10	93081458	missense	unknown
IGL02434:Cfap54	APN	10	93066754	missense	probably benign	0.20
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0011:Cfap54	UTSW	10	93065225	missense	probably damaging	0.97
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0032:Cfap54	UTSW	10	92932697	missense	probably benign	0.04
R0040:Cfap54	UTSW	10	92977039	missense	probably benign	0.33
R0044:Cfap54	UTSW	10	93035433	missense	probably null	0.46
R0086:Cfap54	UTSW	10	93028594	missense	possibly damaging	0.86
R0104:Cfap54	UTSW	10	93028652	missense	probably damaging	1.00
R0194:Cfap54	UTSW	10	93034662	unclassified	probably benign
R0234:Cfap54	UTSW	10	92899160	nonsense	probably null
R0308:Cfap54	UTSW	10	92885364	missense	unknown
R0332:Cfap54	UTSW	10	93035457	missense	probably damaging	1.00
R0409:Cfap54	UTSW	10	92776213	missense	probably benign	0.00
R0433:Cfap54	UTSW	10	92979080	splice site	probably benign
R0436:Cfap54	UTSW	10	93038975	missense	possibly damaging	0.95
R0463:Cfap54	UTSW	10	92874943	critical splice donor site	probably null
R0523:Cfap54	UTSW	10	92908883	utr 3 prime	probably benign
R0551:Cfap54	UTSW	10	93025122	missense	probably benign	0.35
R0595:Cfap54	UTSW	10	92884736	missense	unknown
R0617:Cfap54	UTSW	10	92829650	splice site	probably benign
R0632:Cfap54	UTSW	10	92885096	missense	unknown
R0730:Cfap54	UTSW	10	93034737	missense	probably benign	0.05
R0786:Cfap54	UTSW	10	92967535	missense	possibly damaging	0.72
R0883:Cfap54	UTSW	10	92870669	missense	unknown
R1004:Cfap54	UTSW	10	93066696	splice site	probably benign
R1033:Cfap54	UTSW	10	92839449	missense	probably benign	0.07
R1168:Cfap54	UTSW	10	92937920	missense	probably damaging	0.99
R1186:Cfap54	UTSW	10	92875994	missense	unknown
R1429:Cfap54	UTSW	10	92821038	missense	probably benign	0.01
R1443:Cfap54	UTSW	10	92932721	missense	probably damaging	1.00
R1467:Cfap54	UTSW	10	92969763	missense	probably benign	0.01
R1557:Cfap54	UTSW	10	92984227	missense	possibly damaging	0.68
R1687:Cfap54	UTSW	10	92932640	missense	probably damaging	1.00
R1690:Cfap54	UTSW	10	93035442	missense	possibly damaging	0.95
R1711:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R1756:Cfap54	UTSW	10	93048061	missense	probably damaging	1.00
R1769:Cfap54	UTSW	10	92904263	critical splice donor site	probably null
R1835:Cfap54	UTSW	10	92962375	missense	probably benign	0.35
R1889:Cfap54	UTSW	10	93034710	missense	possibly damaging	0.94
R1915:Cfap54	UTSW	10	92884702	missense	unknown
R1958:Cfap54	UTSW	10	92997342	missense	probably benign	0.18
R2005:Cfap54	UTSW	10	92884768	missense	unknown
R2018:Cfap54	UTSW	10	93016604	missense	probably benign	0.00
R2045:Cfap54	UTSW	10	93038809	splice site	probably null
R2059:Cfap54	UTSW	10	92942979	unclassified	probably benign
R2100:Cfap54	UTSW	10	93001937	missense	possibly damaging	0.84
R2110:Cfap54	UTSW	10	92886367	missense	unknown
R2392:Cfap54	UTSW	10	93025011	critical splice donor site	probably null
R2508:Cfap54	UTSW	10	92997374	missense	possibly damaging	0.72
R2852:Cfap54	UTSW	10	92940155	missense	probably damaging	1.00
R2857:Cfap54	UTSW	10	93045282	missense	probably damaging	0.99
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R2871:Cfap54	UTSW	10	92921419	missense	possibly damaging	0.86
R3107:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3108:Cfap54	UTSW	10	92994683	missense	probably benign	0.04
R3157:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3158:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3159:Cfap54	UTSW	10	92999056	missense	probably benign	0.03
R3161:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3162:Cfap54	UTSW	10	93045278	missense	probably damaging	1.00
R3508:Cfap54	UTSW	10	92885424	missense	unknown
R3730:Cfap54	UTSW	10	93011473	nonsense	probably null
R3770:Cfap54	UTSW	10	92878536	missense	unknown
R3776:Cfap54	UTSW	10	93045100	missense	probably damaging	1.00
R3778:Cfap54	UTSW	10	92904344	utr 3 prime	probably benign
R3795:Cfap54	UTSW	10	92942873	unclassified	probably benign
R3834:Cfap54	UTSW	10	92801123	splice site	probably benign
R3891:Cfap54	UTSW	10	93038846	missense	possibly damaging	0.87
R3932:Cfap54	UTSW	10	92829757	missense	probably benign	0.03
R3973:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3974:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3976:Cfap54	UTSW	10	92839471	missense	possibly damaging	0.95
R3978:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R4190:Cfap54	UTSW	10	92885023	missense	unknown
R4389:Cfap54	UTSW	10	92967500	missense	probably benign	0.37
R4542:Cfap54	UTSW	10	93025129	missense	probably benign	0.12
R4564:Cfap54	UTSW	10	92839540	unclassified	probably benign
R4576:Cfap54	UTSW	10	93043228	critical splice donor site	probably null
R4620:Cfap54	UTSW	10	92969757	missense	probably benign	0.01
R4714:Cfap54	UTSW	10	92815918	missense	probably benign	0.01
R4762:Cfap54	UTSW	10	93061453	splice site	probably null
R4776:Cfap54	UTSW	10	92972694	missense	possibly damaging	0.96
R4819:Cfap54	UTSW	10	92836477	nonsense	probably null
R4827:Cfap54	UTSW	10	92902075	utr 3 prime	probably benign
R4832:Cfap54	UTSW	10	92967528	missense	probably benign	0.01
R4965:Cfap54	UTSW	10	93066799	missense	probably benign	0.23
R5001:Cfap54	UTSW	10	92964534	missense	probably benign	0.01
R5060:Cfap54	UTSW	10	93039151	missense	probably damaging	1.00
R5067:Cfap54	UTSW	10	93066766	missense	probably benign	0.17
R5069:Cfap54	UTSW	10	92937774	missense	probably benign
R5094:Cfap54	UTSW	10	92898999	utr 3 prime	probably benign
R5109:Cfap54	UTSW	10	92937891	missense	probably benign	0.03
R5127:Cfap54	UTSW	10	92886387	splice site	probably null
R5143:Cfap54	UTSW	10	93029158	missense	possibly damaging	0.73
R5147:Cfap54	UTSW	10	92937838	missense	probably benign	0.00
R5158:Cfap54	UTSW	10	93065197	missense	probably damaging	1.00
R5256:Cfap54	UTSW	10	92935091	nonsense	probably null
R5266:Cfap54	UTSW	10	92815902	missense	probably benign	0.16
R5304:Cfap54	UTSW	10	92821106	missense	probably damaging	0.97
R5369:Cfap54	UTSW	10	93061257	intron	probably benign
R5406:Cfap54	UTSW	10	93001858	missense	probably benign	0.33
R5471:Cfap54	UTSW	10	93028660	missense	probably damaging	1.00
R5485:Cfap54	UTSW	10	93029117	missense	probably damaging	1.00
R5540:Cfap54	UTSW	10	92972608	missense	possibly damaging	0.85
R5586:Cfap54	UTSW	10	92972611	nonsense	probably null
R5614:Cfap54	UTSW	10	93045049	missense	probably damaging	1.00
R5634:Cfap54	UTSW	10	92904263	critical splice donor site	probably benign
R5680:Cfap54	UTSW	10	92979017	nonsense	probably null
R5797:Cfap54	UTSW	10	92967576	missense	probably benign	0.11
R5859:Cfap54	UTSW	10	93016524	nonsense	probably null
R5878:Cfap54	UTSW	10	92964561	missense	probably benign	0.01
R5910:Cfap54	UTSW	10	93065181	missense	probably damaging	0.99
R5936:Cfap54	UTSW	10	92962412	missense	probably benign	0.01
R5994:Cfap54	UTSW	10	93039081	missense	probably damaging	0.99
R6080:Cfap54	UTSW	10	93045335	missense	possibly damaging	0.64
R6268:Cfap54	UTSW	10	93038909	missense	probably damaging	1.00
R6296:Cfap54	UTSW	10	93066846	missense	probably damaging	1.00
R6409:Cfap54	UTSW	10	92967492	missense	probably benign	0.04
R6545:Cfap54	UTSW	10	92836457	missense	probably benign	0.31
R6570:Cfap54	UTSW	10	92815958	missense	unknown
R6597:Cfap54	UTSW	10	92999040	missense	possibly damaging	0.85
R6702:Cfap54	UTSW	10	92868734	missense	unknown
R6703:Cfap54	UTSW	10	92868734	missense	unknown
R6720:Cfap54	UTSW	10	92821119	missense	probably benign	0.07
R6841:Cfap54	UTSW	10	92875015	missense	unknown
R6910:Cfap54	UTSW	10	92836512	missense	probably benign	0.29
R6953:Cfap54	UTSW	10	92994678	missense	probably benign	0.19
R7009:Cfap54	UTSW	10	92875019	missense	unknown
R7129:Cfap54	UTSW	10	93016571	missense	probably benign	0.06
R7131:Cfap54	UTSW	10	92821104	missense	probably benign	0.03
R7171:Cfap54	UTSW	10	92776210	missense	probably damaging	0.99
R7189:Cfap54	UTSW	10	92937728	missense	unknown
R7225:Cfap54	UTSW	10	92904374	missense	unknown
R7270:Cfap54	UTSW	10	92839458	missense	probably benign	0.03
R7323:Cfap54	UTSW	10	92801138	missense	probably benign	0.00
R7380:Cfap54	UTSW	10	93047978	missense	probably damaging	1.00
R7395:Cfap54	UTSW	10	92884703	missense	unknown
R7411:Cfap54	UTSW	10	92868755	missense	unknown
R7503:Cfap54	UTSW	10	92887436	splice site	probably null
R7622:Cfap54	UTSW	10	92956944	missense	unknown
R7679:Cfap54	UTSW	10	92967512	missense	probably benign	0.01
R7776:Cfap54	UTSW	10	92868741	missense	unknown
R7844:Cfap54	UTSW	10	92902058	missense	unknown
R7980:Cfap54	UTSW	10	92982060	missense	possibly damaging	0.95
R7988:Cfap54	UTSW	10	92902079	missense	unknown
R8101:Cfap54	UTSW	10	92884796	missense	unknown
R8119:Cfap54	UTSW	10	92868810	missense	unknown
R8134:Cfap54	UTSW	10	92878516	missense	unknown
R8168:Cfap54	UTSW	10	92908877	missense	unknown
R8179:Cfap54	UTSW	10	92997316	missense	possibly damaging	0.68
R8392:Cfap54	UTSW	10	92962417	missense	unknown
R8436:Cfap54	UTSW	10	92964536	missense	unknown
R8505:Cfap54	UTSW	10	92978993	missense	probably benign	0.03
R8671:Cfap54	UTSW	10	92955072	missense	unknown
R8716:Cfap54	UTSW	10	92964632	missense	probably benign	0.00
R8816:Cfap54	UTSW	10	92878592	missense	unknown
R8822:Cfap54	UTSW	10	93039141	missense	probably benign	0.09
R8827:Cfap54	UTSW	10	92938248	missense	unknown
R8920:Cfap54	UTSW	10	92940337	critical splice acceptor site	probably null
R8924:Cfap54	UTSW	10	93001823	missense	probably damaging	0.99
R8954:Cfap54	UTSW	10	93043393	missense	probably damaging	1.00
R8963:Cfap54	UTSW	10	93028700	nonsense	probably null
R9010:Cfap54	UTSW	10	92899059	missense	unknown
R9017:Cfap54	UTSW	10	92816021	missense	probably benign	0.07
R9093:Cfap54	UTSW	10	92815908	missense	probably benign	0.03
R9095:Cfap54	UTSW	10	93011020	missense	probably damaging	1.00
R9142:Cfap54	UTSW	10	92984235	missense	possibly damaging	0.87
R9178:Cfap54	UTSW	10	92994717	missense	probably benign	0.10
R9196:Cfap54	UTSW	10	93037891	missense	probably benign	0.22
R9203:Cfap54	UTSW	10	93045128	missense	probably benign	0.30
R9258:Cfap54	UTSW	10	92935098	missense	unknown
R9275:Cfap54	UTSW	10	93039186	missense	possibly damaging	0.86
R9287:Cfap54	UTSW	10	92969703	missense	possibly damaging	0.50
R9289:Cfap54	UTSW	10	92821074	missense	possibly damaging	0.83
R9310:Cfap54	UTSW	10	92962315	missense	unknown
R9397:Cfap54	UTSW	10	92997285	missense	probably damaging	0.96
R9462:Cfap54	UTSW	10	92902058	missense	unknown
R9697:Cfap54	UTSW	10	92956989	missense	unknown
R9746:Cfap54	UTSW	10	92801219	missense	probably benign	0.03
R9755:Cfap54	UTSW	10	92921368	missense	unknown
X0022:Cfap54	UTSW	10	92878603	missense	unknown
X0022:Cfap54	UTSW	10	92932614	missense	probably damaging	1.00
X0027:Cfap54	UTSW	10	92878538	missense	unknown
X0027:Cfap54	UTSW	10	93001888	missense	possibly damaging	0.86
Z1177:Cfap54	UTSW	10	92979026	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAAGGGGCTTTTATGCAAACC -3'
(R):5'- TCTTAGTGACCGAGTCGTGC -3'

Sequencing Primer
(F):5'- CACCCATTAATGTTGCAAAACTGGG -3'
(R):5'- AGTCGTGCATCCCGTTG -3'

Posted On

2016-07-06