Incidental Mutation 'R0455:Kdm6b'
ID39970
Institutional Source Beutler Lab
Gene Symbol Kdm6b
Ensembl Gene ENSMUSG00000018476
Gene NameKDM1 lysine (K)-specific demethylase 6B
SynonymsJmjd3
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0455 (G1)
Quality Score181
Status Validated
Chromosome11
Chromosomal Location69398508-69413675 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 69406996 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 233 (C233*)
Ref Sequence ENSEMBL: ENSMUSP00000091620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094077]
PDB Structure The free structure of the mouse C-terminal domain of KDM6B [X-RAY DIFFRACTION]
free KDM6B structure [X-RAY DIFFRACTION]
the crystal structure of KDM6B bound with H3K27me3 peptide [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000094077
AA Change: C233*
SMART Domains Protein: ENSMUSP00000091620
Gene: ENSMUSG00000018476
AA Change: C233*

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
low complexity region 54 71 N/A INTRINSIC
SCOP:d1elwa_ 91 152 9e-5 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 239 270 N/A INTRINSIC
low complexity region 312 329 N/A INTRINSIC
low complexity region 333 345 N/A INTRINSIC
low complexity region 389 415 N/A INTRINSIC
low complexity region 461 487 N/A INTRINSIC
low complexity region 515 524 N/A INTRINSIC
low complexity region 544 577 N/A INTRINSIC
low complexity region 585 615 N/A INTRINSIC
low complexity region 643 650 N/A INTRINSIC
low complexity region 711 719 N/A INTRINSIC
low complexity region 743 766 N/A INTRINSIC
low complexity region 771 811 N/A INTRINSIC
low complexity region 840 879 N/A INTRINSIC
low complexity region 890 909 N/A INTRINSIC
low complexity region 950 989 N/A INTRINSIC
low complexity region 993 1011 N/A INTRINSIC
low complexity region 1044 1068 N/A INTRINSIC
low complexity region 1284 1317 N/A INTRINSIC
JmjC 1337 1500 1.61e-47 SMART
Blast:JmjC 1536 1600 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156562
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a lysine-specific demethylase that specifically demethylates di- or tri-methylated lysine 27 of histone H3 (H3K27me2 or H3K27me3). H3K27 trimethylation is a repressive epigenetic mark controlling chromatin organization and gene silencing. This protein can also demethylate non-histone proteins such as retinoblastoma protein. Through its demethylation actvity this gene influences cellular differentiation and development, tumorigenesis, inflammatory diseases, and neurodegenerative diseases. This protein has two classical nuclear localization signals at its N-terminus. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a null allele show perinatal death, thick alveolar septum, and absence of air space in the lungs. Mice homozygous for a different null allele die neonatally displaying abnormal lung development, dwarfism, kyphosis, short limbs, and a severe delay in endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Olfr739 A G 14: 50,424,902 I128V possibly damaging Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Kdm6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Kdm6b APN 11 69406306 missense possibly damaging 0.85
IGL02271:Kdm6b APN 11 69406067 missense possibly damaging 0.65
beine UTSW 11 69403592 missense unknown
Knochen UTSW 11 69400055 unclassified probably benign
Ostentatious UTSW 11 69403598 missense unknown
Piquant UTSW 11 69403794 missense unknown
Tart UTSW 11 69406366 missense probably damaging 1.00
BB007:Kdm6b UTSW 11 69399952 missense unknown
BB017:Kdm6b UTSW 11 69399952 missense unknown
PIT4458001:Kdm6b UTSW 11 69399952 missense unknown
R0645:Kdm6b UTSW 11 69405018 missense unknown
R1659:Kdm6b UTSW 11 69407588 missense possibly damaging 0.88
R1855:Kdm6b UTSW 11 69407286 missense probably damaging 0.99
R1962:Kdm6b UTSW 11 69401365 unclassified probably benign
R1993:Kdm6b UTSW 11 69406303 missense probably null 0.85
R2029:Kdm6b UTSW 11 69403592 missense unknown
R2181:Kdm6b UTSW 11 69401126 nonsense probably null
R2215:Kdm6b UTSW 11 69405044 missense unknown
R2904:Kdm6b UTSW 11 69405785 missense possibly damaging 0.63
R2992:Kdm6b UTSW 11 69406307 small deletion probably benign
R3236:Kdm6b UTSW 11 69406366 missense probably damaging 1.00
R3950:Kdm6b UTSW 11 69405615 missense probably damaging 1.00
R4027:Kdm6b UTSW 11 69406268 missense possibly damaging 0.92
R4830:Kdm6b UTSW 11 69403794 missense unknown
R4996:Kdm6b UTSW 11 69405731 missense probably damaging 1.00
R5034:Kdm6b UTSW 11 69401910 splice site probably benign
R5140:Kdm6b UTSW 11 69400055 unclassified probably benign
R5160:Kdm6b UTSW 11 69400768 unclassified probably benign
R5240:Kdm6b UTSW 11 69401904 splice site probably benign
R5273:Kdm6b UTSW 11 69404201 missense unknown
R5386:Kdm6b UTSW 11 69400810 unclassified probably benign
R5597:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5598:Kdm6b UTSW 11 69406074 missense probably damaging 0.96
R5812:Kdm6b UTSW 11 69405929 missense probably damaging 0.98
R5976:Kdm6b UTSW 11 69403788 critical splice donor site probably null
R6000:Kdm6b UTSW 11 69403598 missense unknown
R6145:Kdm6b UTSW 11 69405026 missense unknown
R6191:Kdm6b UTSW 11 69406758 missense probably benign 0.01
R6256:Kdm6b UTSW 11 69406729 missense probably damaging 0.96
R6304:Kdm6b UTSW 11 69404258 missense unknown
R6917:Kdm6b UTSW 11 69406593 missense probably benign 0.04
R6939:Kdm6b UTSW 11 69406762 missense probably damaging 0.99
R7356:Kdm6b UTSW 11 69402165 nonsense probably null
R7644:Kdm6b UTSW 11 69400206 missense unknown
R7673:Kdm6b UTSW 11 69405742 missense probably damaging 0.98
R7698:Kdm6b UTSW 11 69405981 missense probably benign 0.14
R7776:Kdm6b UTSW 11 69406134 missense possibly damaging 0.84
R7930:Kdm6b UTSW 11 69399952 missense unknown
R8383:Kdm6b UTSW 11 69406050 missense probably benign
R8725:Kdm6b UTSW 11 69402093 missense unknown
R8727:Kdm6b UTSW 11 69402093 missense unknown
R8813:Kdm6b UTSW 11 69406829 small insertion probably benign
R8813:Kdm6b UTSW 11 69406832 small insertion probably benign
Z1177:Kdm6b UTSW 11 69403866 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTCCTAAGGGAGATGATCGAGG -3'
(R):5'- GCAAGTCTGGAATTTGCTGCACC -3'

Sequencing Primer
(F):5'- CAGCggtggtggtggag -3'
(R):5'- CCAGTGAAGAGATCTGCTGAAC -3'
Posted On2013-05-23