Incidental Mutation 'R5180:Tnfrsf1b'
ID399700
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1b
Ensembl Gene ENSMUSG00000028599
Gene Nametumor necrosis factor receptor superfamily, member 1b
SynonymsTNFalpha-R2, TNFBR, CD120b, TNFR80, TNF-R-II, TNF-R75, p75 TNFR, Tnfr2, p75, TNF-R2, TNFRII, TNF-alphaR2
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.375) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location145213463-145246870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 145227497 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 94 (C94F)
Ref Sequence ENSEMBL: ENSMUSP00000030336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030336] [ENSMUST00000143055]
Predicted Effect probably damaging
Transcript: ENSMUST00000030336
AA Change: C94F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030336
Gene: ENSMUSG00000028599
AA Change: C94F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TNFR 40 76 2.15e-9 SMART
TNFR 79 119 2.19e-10 SMART
TNFR 121 163 7.27e-7 SMART
TNFR 166 202 2.22e-2 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
low complexity region 363 378 N/A INTRINSIC
low complexity region 390 405 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143055
SMART Domains Protein: ENSMUSP00000115702
Gene: ENSMUSG00000028599

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Meta Mutation Damage Score 0.9618 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This protein and TNF-receptor 1 form a heterocomplex that mediates the recruitment of two anti-apoptotic proteins, c-IAP1 and c-IAP2, which possess E3 ubiquitin ligase activity. The function of IAPs in TNF-receptor signalling is unknown, however, c-IAP1 is thought to potentiate TNF-induced apoptosis by the ubiquitination and degradation of TNF-receptor-associated factor 2, which mediates anti-apoptotic signals. Knockout studies in mice also suggest a role of this protein in protecting neurons from apoptosis by stimulating antioxidative pathways. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered inflammatory responses in a variety of experimental conditions, impaired recovery from spinal cord injury, enhanced ischemia-reperfusion-induced retinal damage, and resistance to cerebral malaria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Tnfrsf1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Tnfrsf1b APN 4 145225416 missense probably damaging 1.00
IGL01716:Tnfrsf1b APN 4 145215923 missense probably damaging 0.97
IGL01974:Tnfrsf1b APN 4 145215851 missense probably damaging 1.00
IGL02631:Tnfrsf1b APN 4 145224828 missense probably damaging 1.00
R0011:Tnfrsf1b UTSW 4 145222966 missense possibly damaging 0.77
R0135:Tnfrsf1b UTSW 4 145229046 missense probably benign 0.15
R0194:Tnfrsf1b UTSW 4 145224812 missense probably benign 0.04
R0761:Tnfrsf1b UTSW 4 145216100 missense possibly damaging 0.95
R1124:Tnfrsf1b UTSW 4 145224356 missense probably benign 0.23
R1696:Tnfrsf1b UTSW 4 145227474 missense probably benign
R3692:Tnfrsf1b UTSW 4 145227522 missense probably benign 0.01
R4248:Tnfrsf1b UTSW 4 145215965 missense probably benign 0.01
R4409:Tnfrsf1b UTSW 4 145224285 nonsense probably null
R4957:Tnfrsf1b UTSW 4 145246757 missense probably damaging 0.99
R4957:Tnfrsf1b UTSW 4 145246758 missense possibly damaging 0.90
R5425:Tnfrsf1b UTSW 4 145229108 critical splice acceptor site probably null
R6163:Tnfrsf1b UTSW 4 145219907 missense probably benign 0.24
R7055:Tnfrsf1b UTSW 4 145224887 missense probably damaging 1.00
R7891:Tnfrsf1b UTSW 4 145229090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGTTCCAATCACATAACTACAT -3'
(R):5'- GACATGCTTCATCCCAGGG -3'

Sequencing Primer
(F):5'- CTATTGGATAGATCACAGGGCCC -3'
(R):5'- ATGCTTCATCCCAGGGGCTTC -3'
Posted On2016-07-06