Incidental Mutation 'R5180:Dnajc11'
ID399703
Institutional Source Beutler Lab
Gene Symbol Dnajc11
Ensembl Gene ENSMUSG00000039768
Gene NameDnaJ heat shock protein family (Hsp40) member C11
Synonyms
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R5180 (G1)
Quality Score159
Status Validated
Chromosome4
Chromosomal Location151933691-151982137 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 151969939 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 201 (R201C)
Ref Sequence ENSEMBL: ENSMUSP00000051643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062904] [ENSMUST00000139069] [ENSMUST00000147625]
Predicted Effect probably damaging
Transcript: ENSMUST00000062904
AA Change: R201C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051643
Gene: ENSMUSG00000039768
AA Change: R201C

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
Pfam:DUF3395 410 549 2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123551
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138738
Predicted Effect probably benign
Transcript: ENSMUST00000139069
SMART Domains Protein: ENSMUSP00000119604
Gene: ENSMUSG00000039768

DomainStartEndE-ValueType
DnaJ 13 74 4.41e-24 SMART
low complexity region 102 122 N/A INTRINSIC
coiled coil region 318 349 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142198
Predicted Effect probably benign
Transcript: ENSMUST00000147625
SMART Domains Protein: ENSMUSP00000122140
Gene: ENSMUSG00000039768

DomainStartEndE-ValueType
DnaJ 1 36 2.51e-1 SMART
low complexity region 64 84 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148048
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit motor neuron pathology, disorganized cristae and lymphoid abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Dnajc11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01769:Dnajc11 APN 4 151979302 missense probably damaging 0.99
IGL02253:Dnajc11 APN 4 151950519 nonsense probably null
IGL02606:Dnajc11 APN 4 151979484 missense probably benign 0.18
IGL02969:Dnajc11 APN 4 151978046 missense probably benign 0.33
IGL03062:Dnajc11 APN 4 151970861 missense possibly damaging 0.92
PIT4812001:Dnajc11 UTSW 4 151952889 missense probably benign 0.04
R0601:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R0620:Dnajc11 UTSW 4 151973628 missense possibly damaging 0.54
R0639:Dnajc11 UTSW 4 151969936 missense probably damaging 1.00
R1694:Dnajc11 UTSW 4 151979273 missense probably damaging 1.00
R4091:Dnajc11 UTSW 4 151978093 unclassified probably benign
R4545:Dnajc11 UTSW 4 151979941 missense probably damaging 1.00
R4548:Dnajc11 UTSW 4 151973617 missense possibly damaging 0.93
R4720:Dnajc11 UTSW 4 151968539 missense probably damaging 1.00
R4732:Dnajc11 UTSW 4 151970967 unclassified probably benign
R4751:Dnajc11 UTSW 4 151968542 missense probably benign 0.01
R4895:Dnajc11 UTSW 4 151979933 missense probably damaging 1.00
R5122:Dnajc11 UTSW 4 151976997 missense possibly damaging 0.63
R5127:Dnajc11 UTSW 4 151969814 unclassified probably benign
R5174:Dnajc11 UTSW 4 151979984 missense probably damaging 1.00
R5319:Dnajc11 UTSW 4 151968526 missense probably damaging 1.00
R5624:Dnajc11 UTSW 4 151979510 missense probably benign
R6056:Dnajc11 UTSW 4 151978126 unclassified probably benign
R6434:Dnajc11 UTSW 4 151979294 missense probably damaging 1.00
R7635:Dnajc11 UTSW 4 151968611 missense probably damaging 1.00
R7652:Dnajc11 UTSW 4 151974225 missense probably damaging 0.99
R7937:Dnajc11 UTSW 4 151950452 missense probably damaging 1.00
R7940:Dnajc11 UTSW 4 151968588 missense probably benign 0.00
R8093:Dnajc11 UTSW 4 151969900 missense probably damaging 1.00
R8361:Dnajc11 UTSW 4 151970911 missense probably damaging 0.99
Z1176:Dnajc11 UTSW 4 151933783 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCATGCATTGGTGTGAAGG -3'
(R):5'- CACTGCAAAGGACATGGATTG -3'

Sequencing Primer
(F):5'- AGAGCAGCTGAGCAGGCC -3'
(R):5'- GCCTATCTCTCTTGTGTGG -3'
Posted On2016-07-06