Incidental Mutation 'R5180:Vmn2r16'
ID399706
Institutional Source Beutler Lab
Gene Symbol Vmn2r16
Ensembl Gene ENSMUSG00000092080
Gene Namevomeronasal 2, receptor 16
SynonymsEG384220
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109330381-109364481 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 109330525 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 49 (V49F)
Ref Sequence ENSEMBL: ENSMUSP00000127838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165180]
Predicted Effect probably benign
Transcript: ENSMUST00000165180
AA Change: V49F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127838
Gene: ENSMUSG00000092080
AA Change: V49F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 76 425 2.3e-28 PFAM
Pfam:NCD3G 509 563 8.2e-19 PFAM
Pfam:7tm_3 596 831 3.5e-56 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Vmn2r16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Vmn2r16 APN 5 109340428 missense probably damaging 1.00
IGL01374:Vmn2r16 APN 5 109330417 missense probably benign 0.00
IGL01391:Vmn2r16 APN 5 109363761 missense possibly damaging 0.50
IGL01419:Vmn2r16 APN 5 109362401 splice site probably benign
IGL01634:Vmn2r16 APN 5 109340311 missense probably benign 0.00
IGL01845:Vmn2r16 APN 5 109363896 missense probably damaging 1.00
IGL01875:Vmn2r16 APN 5 109330411 missense probably benign 0.01
IGL01910:Vmn2r16 APN 5 109340085 missense probably damaging 1.00
IGL02217:Vmn2r16 APN 5 109339810 missense probably damaging 0.98
IGL02327:Vmn2r16 APN 5 109340121 missense probably benign 0.01
IGL02491:Vmn2r16 APN 5 109339837 nonsense probably null
IGL02531:Vmn2r16 APN 5 109340268 missense probably damaging 0.99
IGL02680:Vmn2r16 APN 5 109340082 missense probably benign 0.44
IGL02884:Vmn2r16 APN 5 109360891 missense possibly damaging 0.94
IGL03084:Vmn2r16 APN 5 109330426 missense probably damaging 0.99
IGL03096:Vmn2r16 APN 5 109339885 missense probably damaging 0.99
IGL03355:Vmn2r16 APN 5 109363714 missense possibly damaging 0.74
R0280:Vmn2r16 UTSW 5 109340139 missense possibly damaging 0.88
R0594:Vmn2r16 UTSW 5 109363896 missense probably damaging 1.00
R1016:Vmn2r16 UTSW 5 109339888 missense probably damaging 1.00
R1109:Vmn2r16 UTSW 5 109339786 missense probably damaging 0.98
R1248:Vmn2r16 UTSW 5 109360777 missense probably benign 0.10
R1626:Vmn2r16 UTSW 5 109363577 missense probably damaging 1.00
R1909:Vmn2r16 UTSW 5 109363987 missense probably benign 0.01
R1929:Vmn2r16 UTSW 5 109339258 missense possibly damaging 0.92
R1982:Vmn2r16 UTSW 5 109364024 missense probably benign 0.01
R3038:Vmn2r16 UTSW 5 109339333 missense probably damaging 1.00
R3437:Vmn2r16 UTSW 5 109330496 missense probably damaging 0.99
R3734:Vmn2r16 UTSW 5 109330414 missense probably benign 0.11
R3820:Vmn2r16 UTSW 5 109362277 missense probably benign 0.36
R3873:Vmn2r16 UTSW 5 109340311 missense probably benign 0.33
R4165:Vmn2r16 UTSW 5 109330561 missense possibly damaging 0.80
R4373:Vmn2r16 UTSW 5 109363801 missense probably damaging 1.00
R4575:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4576:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4578:Vmn2r16 UTSW 5 109363799 missense possibly damaging 0.81
R4637:Vmn2r16 UTSW 5 109330414 missense probably benign 0.00
R4696:Vmn2r16 UTSW 5 109339302 missense probably benign 0.01
R5026:Vmn2r16 UTSW 5 109360856 nonsense probably null
R5433:Vmn2r16 UTSW 5 109363842 missense probably damaging 1.00
R5955:Vmn2r16 UTSW 5 109363747 missense possibly damaging 0.78
R5958:Vmn2r16 UTSW 5 109362287 missense possibly damaging 0.81
R6353:Vmn2r16 UTSW 5 109340253 missense probably benign 0.33
R6389:Vmn2r16 UTSW 5 109330478 missense probably benign 0.19
R6819:Vmn2r16 UTSW 5 109340546 missense probably benign 0.04
R6994:Vmn2r16 UTSW 5 109340103 missense probably damaging 1.00
R7061:Vmn2r16 UTSW 5 109363754 missense probably damaging 0.99
R7063:Vmn2r16 UTSW 5 109363784 missense probably damaging 1.00
R7220:Vmn2r16 UTSW 5 109360906 missense probably damaging 0.97
R7268:Vmn2r16 UTSW 5 109340465 nonsense probably null
R7420:Vmn2r16 UTSW 5 109363870 missense probably damaging 0.96
R7591:Vmn2r16 UTSW 5 109362357 missense probably damaging 0.99
R7644:Vmn2r16 UTSW 5 109339971 missense probably damaging 1.00
R7939:Vmn2r16 UTSW 5 109339839 missense possibly damaging 0.79
R7977:Vmn2r16 UTSW 5 109340149 missense probably damaging 1.00
R7987:Vmn2r16 UTSW 5 109340149 missense probably damaging 1.00
R8023:Vmn2r16 UTSW 5 109340406 nonsense probably null
R8427:Vmn2r16 UTSW 5 109340272 missense probably benign 0.03
R8436:Vmn2r16 UTSW 5 109363783 missense probably damaging 1.00
X0027:Vmn2r16 UTSW 5 109339309 missense probably damaging 1.00
Z1088:Vmn2r16 UTSW 5 109340515 missense probably benign 0.03
Z1088:Vmn2r16 UTSW 5 109363913 frame shift probably null
Z1177:Vmn2r16 UTSW 5 109339998 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GCTCTGTCTTAGAACCTAGCAG -3'
(R):5'- GGTGCCCAATATTCTAAAACCAAG -3'

Sequencing Primer
(F):5'- CTCTGTCTTAGAACCTAGCAGACATG -3'
(R):5'- TTACCTGGGAAGAACAGG -3'
Posted On2016-07-06