Incidental Mutation 'R5256:Myh6'
ID399712
Institutional Source Beutler Lab
Gene Symbol Myh6
Ensembl Gene ENSMUSG00000040752
Gene Namemyosin, heavy polypeptide 6, cardiac muscle, alpha
Synonymsalpha myosin, A830009F23Rik, alpha cardiac MHC, cardiomyopathy, hypertrophic 1, Myhca, Myhc-a, alpha-MHC
MMRRC Submission 042827-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5256 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location54941921-54966927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54952661 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1055 (R1055Q)
Ref Sequence ENSEMBL: ENSMUSP00000154634 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081857] [ENSMUST00000226297]
Predicted Effect probably damaging
Transcript: ENSMUST00000081857
AA Change: R1055Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080538
Gene: ENSMUSG00000040752
AA Change: R1055Q

DomainStartEndE-ValueType
Pfam:Myosin_N 34 73 1.9e-15 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
Pfam:Myosin_tail_1 845 1926 2.1e-162 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131892
Predicted Effect probably damaging
Transcript: ENSMUST00000145322
AA Change: R1055Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115326
Gene: ENSMUSG00000040752
AA Change: R1055Q

DomainStartEndE-ValueType
Pfam:Myosin_N 34 75 5.3e-17 PFAM
MYSc 79 781 N/A SMART
IQ 782 804 1.15e-1 SMART
IQ 808 830 3.32e2 SMART
coiled coil region 842 1112 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226297
AA Change: R1055Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2595 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency 97% (95/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cardiac muscle myosin is a hexamer consisting of two heavy chain subunits, two light chain subunits, and two regulatory subunits. This gene encodes the alpha heavy chain subunit of cardiac myosin. The gene is located approximately 4kb downstream of the gene encoding the beta heavy chain subunit of cardiac myosin. Mutations in this gene cause familial hypertrophic cardiomyopathy and atrial septal defect 3. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality associated with heart defects while heterozygotes show cardiac myofibrillar disarray, cardiac dysfunction and fibrosis. Mice heterozygous for different knock-in alleles may develop hypertrophic or dilated forms of cardiomyopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730015C16Rik C A 4: 108,848,065 probably benign Het
Actr1b T C 1: 36,700,092 H372R probably benign Het
Ampd2 C A 3: 108,079,549 probably benign Het
Anapc4 A G 5: 52,863,594 S612G probably benign Het
Arhgef7 T C 8: 11,800,811 L141P probably damaging Het
Atl1 A G 12: 69,959,333 D471G probably damaging Het
Atrn A G 2: 130,946,019 D247G probably benign Het
Bag1 T A 4: 40,948,022 R61W probably damaging Het
Card10 C T 15: 78,778,251 R898H probably damaging Het
Cct6b G A 11: 82,764,220 A3V probably damaging Het
Cfap54 A T 10: 92,935,091 L2097* probably null Het
Cfap54 T C 10: 93,045,023 probably null Het
Chd5 T C 4: 152,372,097 F964L probably benign Het
Cog5 A G 12: 31,886,205 T584A probably benign Het
Cpa2 T A 6: 30,547,197 N157K probably damaging Het
Cpeb1 A T 7: 81,351,839 M440K probably damaging Het
Cracr2a G A 6: 127,604,029 C56Y probably damaging Het
Ddb2 A C 2: 91,236,728 L30R probably damaging Het
Dlk1 T A 12: 109,459,771 I190N probably damaging Het
Dnajc13 T A 9: 104,203,329 Y851F possibly damaging Het
Dopey1 T A 9: 86,515,328 L895Q probably damaging Het
Dyx1c1 T C 9: 72,972,080 probably null Het
F7 G A 8: 13,030,763 C122Y probably damaging Het
Frrs1 T C 3: 116,903,100 V573A possibly damaging Het
Gm17541 A T 12: 4,689,672 probably benign Het
Gm20388 T C 8: 122,270,436 probably benign Het
Gm5519 A T 19: 33,823,176 H90L probably damaging Het
Gm5526 T A 1: 45,857,409 noncoding transcript Het
Gm5709 A T 3: 59,602,550 noncoding transcript Het
Golga4 T A 9: 118,556,501 V869D possibly damaging Het
Grm7 A T 6: 111,358,221 Q531L probably benign Het
Hnrnpu C A 1: 178,335,893 C265F unknown Het
Hoxd3 G A 2: 74,746,867 V364I possibly damaging Het
Hspb8 T C 5: 116,409,473 D150G probably damaging Het
Hydin C A 8: 110,587,223 N4244K possibly damaging Het
Ik A G 18: 36,748,873 D136G probably benign Het
Il11ra1 T C 4: 41,767,932 probably benign Het
Jph1 T C 1: 17,091,398 I347V probably benign Het
Klk1 T A 7: 44,221,561 probably benign Het
Lmcd1 T A 6: 112,288,126 probably benign Het
Lnx1 C T 5: 74,685,654 C45Y probably damaging Het
Macc1 T A 12: 119,446,529 M344K possibly damaging Het
Madcam1 A G 10: 79,664,945 E32G possibly damaging Het
Mat2a T C 6: 72,434,333 D383G probably benign Het
Mpst T A 15: 78,413,649 I289N probably damaging Het
Myh7 T C 14: 54,979,508 K1131E probably damaging Het
Ndrg3 A T 2: 156,931,205 probably benign Het
Nebl A G 2: 17,433,975 S209P probably benign Het
Nid2 A G 14: 19,768,208 probably null Het
Nup188 A T 2: 30,330,749 S945C probably damaging Het
Olfr1000 C T 2: 85,608,473 V146I probably benign Het
Olfr251 A G 9: 38,377,917 N12S probably benign Het
Olfr50 A G 2: 36,793,673 M146V probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Patl2 A G 2: 122,128,887 L32P probably damaging Het
Pcdh20 T A 14: 88,468,377 M496L probably benign Het
Pdzd2 A G 15: 12,372,942 V2369A possibly damaging Het
Pfn2 A G 3: 57,847,391 V31A probably damaging Het
Plxna4 T C 6: 32,251,072 N533S probably benign Het
Plxnb1 T C 9: 109,114,593 F1916S probably damaging Het
Ppp4r3b T C 11: 29,188,293 F214L probably benign Het
Prox1 T C 1: 190,161,441 D269G probably benign Het
Rapgef4 T C 2: 72,034,034 F71S probably damaging Het
Rft1 A G 14: 30,661,286 I94M probably benign Het
S100z T C 13: 95,478,619 I13V probably damaging Het
Serhl T A 15: 83,102,634 V117E probably damaging Het
Shroom1 G A 11: 53,465,507 R336Q probably benign Het
Sik3 A T 9: 46,212,254 Q1067L probably damaging Het
Slc22a30 G A 19: 8,344,393 Q436* probably null Het
Slc28a1 G A 7: 81,122,121 V118M probably damaging Het
Slco1a6 T A 6: 142,132,701 I153F probably benign Het
Ss18l1 T C 2: 180,061,942 Y323H unknown Het
Susd4 G T 1: 182,892,259 A480S possibly damaging Het
Syne3 A T 12: 104,975,880 M1K probably null Het
Synpo2l A T 14: 20,661,014 S513T probably benign Het
Tat A T 8: 109,998,334 N388I probably benign Het
Tbc1d1 A G 5: 64,282,009 Y619C probably damaging Het
Tbk1 G A 10: 121,570,685 T216M probably damaging Het
Tns1 C T 1: 73,995,426 probably benign Het
Trbv5 T C 6: 41,062,384 V9A possibly damaging Het
Trpm5 A G 7: 143,082,303 Y575H probably damaging Het
Ttn A T 2: 76,739,701 Y25203* probably null Het
Tubb3 C A 8: 123,421,652 D441E probably benign Het
Usp33 T A 3: 152,391,696 C850* probably null Het
Vdac1 G A 11: 52,384,078 probably null Het
Vmn1r232 T C 17: 20,913,584 I251M probably damaging Het
Vmn2r11 T G 5: 109,054,792 I140L probably benign Het
Vmn2r6 A T 3: 64,556,842 N190K probably benign Het
Vps51 T A 19: 6,070,488 H465L probably benign Het
Zfp318 T G 17: 46,412,069 I1666S probably benign Het
Zfp446 C T 7: 12,979,304 R90* probably null Het
Zgrf1 T A 3: 127,602,445 F547I probably damaging Het
Other mutations in Myh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Myh6 APN 14 54946993 missense probably benign 0.13
IGL00401:Myh6 APN 14 54953417 missense probably benign 0.00
IGL01062:Myh6 APN 14 54952292 missense probably damaging 0.99
IGL01300:Myh6 APN 14 54963091 missense possibly damaging 0.94
IGL01688:Myh6 APN 14 54963960 missense possibly damaging 0.74
IGL01695:Myh6 APN 14 54957413 missense probably benign 0.01
IGL01762:Myh6 APN 14 54962081 missense probably benign 0.17
IGL01803:Myh6 APN 14 54944543 missense probably damaging 1.00
IGL02079:Myh6 APN 14 54950541 missense probably damaging 1.00
IGL02315:Myh6 APN 14 54953834 missense probably damaging 1.00
IGL02340:Myh6 APN 14 54957155 missense possibly damaging 0.76
IGL02377:Myh6 APN 14 54944318 missense probably benign 0.10
IGL02715:Myh6 APN 14 54946908 unclassified probably benign
IGL02742:Myh6 APN 14 54953924 missense possibly damaging 0.62
P0028:Myh6 UTSW 14 54963637 missense probably benign
PIT4520001:Myh6 UTSW 14 54950124 missense probably benign 0.00
R0058:Myh6 UTSW 14 54963404 missense probably damaging 1.00
R0090:Myh6 UTSW 14 54958704 missense probably damaging 0.97
R0360:Myh6 UTSW 14 54948347 nonsense probably null
R0364:Myh6 UTSW 14 54948347 nonsense probably null
R0395:Myh6 UTSW 14 54946320 missense possibly damaging 0.94
R0549:Myh6 UTSW 14 54958608 missense probably damaging 1.00
R0559:Myh6 UTSW 14 54958554 missense probably benign
R0800:Myh6 UTSW 14 54953278 splice site probably benign
R0892:Myh6 UTSW 14 54947054 missense probably benign 0.17
R0975:Myh6 UTSW 14 54953369 missense probably damaging 1.00
R1051:Myh6 UTSW 14 54949527 missense probably benign 0.12
R1180:Myh6 UTSW 14 54944468 missense possibly damaging 0.93
R1311:Myh6 UTSW 14 54946365 missense probably damaging 0.96
R1490:Myh6 UTSW 14 54962718 nonsense probably null
R1531:Myh6 UTSW 14 54956506 missense probably damaging 1.00
R1835:Myh6 UTSW 14 54957401 missense probably benign 0.03
R1845:Myh6 UTSW 14 54944674 missense probably damaging 1.00
R2033:Myh6 UTSW 14 54963645 missense probably benign 0.00
R2143:Myh6 UTSW 14 54952954 missense probably damaging 1.00
R2146:Myh6 UTSW 14 54953771 missense probably damaging 1.00
R2155:Myh6 UTSW 14 54953794 missense probably benign
R2484:Myh6 UTSW 14 54961242 nonsense probably null
R3155:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3156:Myh6 UTSW 14 54944668 missense probably damaging 0.97
R3780:Myh6 UTSW 14 54963958 missense probably benign 0.00
R3906:Myh6 UTSW 14 54956955 missense probably benign 0.04
R3937:Myh6 UTSW 14 54963055 missense probably benign 0.00
R3938:Myh6 UTSW 14 54963055 missense probably benign 0.00
R4236:Myh6 UTSW 14 54960362 missense probably benign 0.15
R4373:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4374:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4377:Myh6 UTSW 14 54962108 missense probably damaging 0.97
R4798:Myh6 UTSW 14 54953293 missense probably damaging 1.00
R4844:Myh6 UTSW 14 54947194 missense possibly damaging 0.89
R4908:Myh6 UTSW 14 54956962 missense probably damaging 1.00
R5277:Myh6 UTSW 14 54956562 missense probably benign 0.01
R5356:Myh6 UTSW 14 54953762 missense probably damaging 1.00
R5433:Myh6 UTSW 14 54953924 missense probably benign 0.32
R5616:Myh6 UTSW 14 54956581 missense probably benign 0.17
R5784:Myh6 UTSW 14 54953064 missense possibly damaging 0.93
R5820:Myh6 UTSW 14 54958680 missense probably damaging 0.99
R5835:Myh6 UTSW 14 54950407 missense probably damaging 1.00
R5922:Myh6 UTSW 14 54946474 missense probably damaging 0.99
R5975:Myh6 UTSW 14 54950508 missense probably benign 0.31
R5988:Myh6 UTSW 14 54965394 missense probably damaging 1.00
R6630:Myh6 UTSW 14 54942001 missense probably benign 0.01
R6845:Myh6 UTSW 14 54944749 missense probably benign
R7009:Myh6 UTSW 14 54952292 missense probably damaging 0.99
R7154:Myh6 UTSW 14 54960307 missense probably benign 0.43
R7293:Myh6 UTSW 14 54947174 missense probably benign 0.00
R7313:Myh6 UTSW 14 54960270 missense probably benign 0.00
R7339:Myh6 UTSW 14 54961568 intron probably null
R7348:Myh6 UTSW 14 54952259 missense probably damaging 1.00
R7487:Myh6 UTSW 14 54953496 nonsense probably null
R7680:Myh6 UTSW 14 54948733 missense possibly damaging 0.88
R7726:Myh6 UTSW 14 54965365 missense probably damaging 0.99
R7743:Myh6 UTSW 14 54957150 missense probably damaging 0.99
R7807:Myh6 UTSW 14 54942440 missense probably damaging 1.00
Z1088:Myh6 UTSW 14 54956997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCAGTGTGTCCAGGGAAG -3'
(R):5'- TATGACCCCAGGAGCTTCTCTG -3'

Sequencing Primer
(F):5'- TGTGTCCAGGGAAGCCAAGC -3'
(R):5'- GTTCTCTGGGATTCCTCATCAGG -3'
Posted On2016-07-06