Incidental Mutation 'R5180:Ppfibp1'
ID399713
Institutional Source Beutler Lab
Gene Symbol Ppfibp1
Ensembl Gene ENSMUSG00000016487
Gene NamePTPRF interacting protein, binding protein 1 (liprin beta 1)
Synonyms
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.604) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location146888487-147032025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 147027321 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 813 (R813L)
Ref Sequence ENSEMBL: ENSMUSP00000107250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000111623]
Predicted Effect probably damaging
Transcript: ENSMUST00000016631
AA Change: R802L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487
AA Change: R802L

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111623
AA Change: R813L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487
AA Change: R813L

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205044
Meta Mutation Damage Score 0.8218 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein was found to interact with S100A4, a calcium-binding protein related to tumor invasiveness and metastasis. In vitro experiment demonstrated that the interaction inhibited the phosphorylation of this protein by protein kinase C and protein kinase CK2. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Ppfibp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ppfibp1 APN 6 147029697 missense probably benign 0.07
IGL02644:Ppfibp1 APN 6 147022440 missense probably damaging 1.00
IGL02711:Ppfibp1 APN 6 147026238 nonsense probably null
IGL02737:Ppfibp1 APN 6 147027308 missense probably damaging 1.00
IGL02745:Ppfibp1 APN 6 147022354 unclassified probably benign
IGL03120:Ppfibp1 APN 6 146998169 missense probably benign 0.00
IGL03300:Ppfibp1 APN 6 147030327 missense probably damaging 1.00
R0114:Ppfibp1 UTSW 6 146998233 missense probably benign 0.04
R0480:Ppfibp1 UTSW 6 147019031 splice site probably null
R0699:Ppfibp1 UTSW 6 147026222 missense probably damaging 0.99
R1515:Ppfibp1 UTSW 6 147027432 missense probably benign
R1830:Ppfibp1 UTSW 6 147022259 critical splice donor site probably null
R1858:Ppfibp1 UTSW 6 146990592 missense probably benign 0.06
R2160:Ppfibp1 UTSW 6 147027453 missense probably damaging 0.98
R2389:Ppfibp1 UTSW 6 147022171 missense probably damaging 1.00
R2517:Ppfibp1 UTSW 6 146992444 missense probably damaging 1.00
R3882:Ppfibp1 UTSW 6 146998221 missense possibly damaging 0.67
R4035:Ppfibp1 UTSW 6 146996836 missense probably damaging 0.99
R4202:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4205:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4420:Ppfibp1 UTSW 6 147026238 nonsense probably null
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4974:Ppfibp1 UTSW 6 147030419 utr 3 prime probably benign
R5163:Ppfibp1 UTSW 6 147022131 splice site probably null
R5388:Ppfibp1 UTSW 6 146996840 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 147016330 missense probably damaging 1.00
R5458:Ppfibp1 UTSW 6 147012435 intron probably benign
R5479:Ppfibp1 UTSW 6 147030150 critical splice donor site probably null
R5631:Ppfibp1 UTSW 6 146996860 missense probably damaging 1.00
R6277:Ppfibp1 UTSW 6 147005924 missense probably benign 0.01
R6577:Ppfibp1 UTSW 6 146999655 splice site probably null
R6602:Ppfibp1 UTSW 6 146978221 missense possibly damaging 0.62
R7320:Ppfibp1 UTSW 6 146978053 missense probably damaging 1.00
R7440:Ppfibp1 UTSW 6 147019503 missense probably benign 0.01
R7455:Ppfibp1 UTSW 6 147016350 missense probably damaging 1.00
R7710:Ppfibp1 UTSW 6 146996405 missense probably benign 0.00
R8379:Ppfibp1 UTSW 6 147030345 missense probably damaging 1.00
R8439:Ppfibp1 UTSW 6 147000950 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTCTCTCGGGCACAGTGATATG -3'
(R):5'- ACCAACCTTCACTTTGGCAG -3'

Sequencing Primer
(F):5'- GGTTTAGTTCTCAGTACCCACATGG -3'
(R):5'- ACTTTGGCAGTGGCTGTTAGC -3'
Posted On2016-07-06