Incidental Mutation 'R5180:Dhx34'
ID399717
Institutional Source Beutler Lab
Gene Symbol Dhx34
Ensembl Gene ENSMUSG00000006019
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 34
Synonyms1200013B07Rik, Ddx34, 1810012L18Rik
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16197147-16222037 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 16205480 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 663 (G663*)
Ref Sequence ENSEMBL: ENSMUSP00000126915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094816] [ENSMUST00000118795] [ENSMUST00000119102] [ENSMUST00000121123] [ENSMUST00000163968]
Predicted Effect probably null
Transcript: ENSMUST00000094816
AA Change: G663*
SMART Domains Protein: ENSMUSP00000092410
Gene: ENSMUSG00000006019
AA Change: G663*

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 2.6e-24 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000118795
AA Change: G663*
SMART Domains Protein: ENSMUSP00000112865
Gene: ENSMUSG00000006019
AA Change: G663*

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119102
AA Change: G663*
SMART Domains Protein: ENSMUSP00000113393
Gene: ENSMUSG00000006019
AA Change: G663*

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121123
AA Change: G663*
SMART Domains Protein: ENSMUSP00000113673
Gene: ENSMUSG00000006019
AA Change: G663*

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 7.5e-17 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133518
Predicted Effect probably null
Transcript: ENSMUST00000163968
AA Change: G663*
SMART Domains Protein: ENSMUSP00000126915
Gene: ENSMUSG00000006019
AA Change: G663*

DomainStartEndE-ValueType
low complexity region 4 26 N/A INTRINSIC
low complexity region 118 131 N/A INTRINSIC
DEXDc 150 343 7.73e-28 SMART
HELICc 400 498 4.31e-17 SMART
low complexity region 542 553 N/A INTRINSIC
HA2 558 648 3.35e-21 SMART
Pfam:OB_NTP_bind 687 911 6.4e-18 PFAM
low complexity region 953 971 N/A INTRINSIC
ZnF_C2H2 1121 1144 7.89e0 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. It is mapped to the glioma 19q tumor suppressor region and is a tumor suppressor candidate gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Dhx34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Dhx34 APN 7 16199826 missense probably damaging 1.00
IGL01090:Dhx34 APN 7 16216256 missense probably damaging 1.00
IGL01397:Dhx34 APN 7 16210543 missense probably damaging 1.00
IGL01637:Dhx34 APN 7 16205473 missense probably damaging 1.00
IGL01684:Dhx34 APN 7 16203279 missense probably damaging 1.00
IGL02147:Dhx34 APN 7 16204003 missense probably benign 0.01
IGL02223:Dhx34 APN 7 16198659 missense probably benign 0.10
R0255:Dhx34 UTSW 7 16205992 missense probably benign 0.32
R0514:Dhx34 UTSW 7 16210537 missense probably benign 0.02
R0919:Dhx34 UTSW 7 16201958 missense probably damaging 0.99
R1075:Dhx34 UTSW 7 16218349 missense probably benign 0.06
R1077:Dhx34 UTSW 7 16218368 missense probably damaging 0.97
R4197:Dhx34 UTSW 7 16203726 missense probably damaging 1.00
R4721:Dhx34 UTSW 7 16197382 missense possibly damaging 0.83
R4856:Dhx34 UTSW 7 16215442 missense possibly damaging 0.94
R4868:Dhx34 UTSW 7 16199802 missense probably benign 0.10
R5134:Dhx34 UTSW 7 16218250 missense possibly damaging 0.57
R5560:Dhx34 UTSW 7 16218541 missense probably benign 0.34
R5588:Dhx34 UTSW 7 16198900 missense probably damaging 0.99
R6981:Dhx34 UTSW 7 16215330 missense possibly damaging 0.87
R6994:Dhx34 UTSW 7 16203874 missense probably benign 0.04
R7226:Dhx34 UTSW 7 16198876 missense probably damaging 1.00
R7262:Dhx34 UTSW 7 16203698 missense probably benign 0.01
R7288:Dhx34 UTSW 7 16215436 missense probably benign 0.08
R7381:Dhx34 UTSW 7 16215448 missense probably benign 0.00
R7469:Dhx34 UTSW 7 16216439 missense probably benign 0.00
R7709:Dhx34 UTSW 7 16212864 missense possibly damaging 0.55
R7862:Dhx34 UTSW 7 16210523 missense probably damaging 0.98
X0020:Dhx34 UTSW 7 16205992 missense probably benign 0.32
Z1176:Dhx34 UTSW 7 16218644 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTTGCCACCTTGCCAAG -3'
(R):5'- TCATCAGTGGCAGTTCAGG -3'

Sequencing Primer
(F):5'- AAGGCTGCCCCAGTCCTG -3'
(R):5'- TAACCCAGCATGCTGTCTGG -3'
Posted On2016-07-06