Mutagenetix > Incidental Mutation

Incidental Mutation 'R5256:Pdzd2'

399718

Institutional Source

Beutler Lab

Gene Symbol

Pdzd2

Ensembl Gene

ENSMUSG00000022197

Gene Name

PDZ domain containing 2

Synonyms

Pdzk3, A930022H17Rik, 4930537L06Rik, Gm21706, LOC223364

MMRRC Submission

042827-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R5256 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

12359711-12739924 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12372942 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 2369 (V2369A)

Ref Sequence

ENSEMBL: ENSMUSP00000074788 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075317]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075317
AA Change: V2369A

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000074788
Gene: ENSMUSG00000022197
AA Change: V2369A

Domain	Start	End	E-Value	Type
PDZ	81	179	1.27e-2	SMART
PDZ	342	419	1.51e-18	SMART
PDZ	597	675	5.25e-18	SMART
low complexity region	690	718	N/A	INTRINSIC
PDZ	738	817	1.64e-10	SMART
low complexity region	861	869	N/A	INTRINSIC
low complexity region	969	984	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
low complexity region	1436	1459	N/A	INTRINSIC
low complexity region	1525	1537	N/A	INTRINSIC
low complexity region	1538	1553	N/A	INTRINSIC
low complexity region	1567	1586	N/A	INTRINSIC
low complexity region	2111	2129	N/A	INTRINSIC
low complexity region	2190	2198	N/A	INTRINSIC
low complexity region	2335	2354	N/A	INTRINSIC
low complexity region	2469	2479	N/A	INTRINSIC
PDZ	2589	2666	1.3e-13	SMART
PDZ	2716	2794	9.42e-20	SMART

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.4%
20x: 92.8%

Validation Efficiency

97% (95/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains six PDZ domains and shares sequence similarity with pro-interleukin-16 (pro-IL-16). Like pro-IL-16, the encoded protein localizes to the endoplasmic reticulum and is thought to be cleaved by a caspase to produce a secreted peptide containing two PDZ domains. In addition, this gene is upregulated in primary prostate tumors and may be involved in the early stages of prostate tumorigenesis. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal response to acute and chronic pain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A730015C16Rik	C	A	4: 108,848,065		probably benign	Het
Actr1b	T	C	1: 36,700,092	H372R	probably benign	Het
Ampd2	C	A	3: 108,079,549		probably benign	Het
Anapc4	A	G	5: 52,863,594	S612G	probably benign	Het
Arhgef7	T	C	8: 11,800,811	L141P	probably damaging	Het
Atl1	A	G	12: 69,959,333	D471G	probably damaging	Het
Atrn	A	G	2: 130,946,019	D247G	probably benign	Het
Bag1	T	A	4: 40,948,022	R61W	probably damaging	Het
Card10	C	T	15: 78,778,251	R898H	probably damaging	Het
Cct6b	G	A	11: 82,764,220	A3V	probably damaging	Het
Cfap54	A	T	10: 92,935,091	L2097*	probably null	Het
Cfap54	T	C	10: 93,045,023		probably null	Het
Chd5	T	C	4: 152,372,097	F964L	probably benign	Het
Cog5	A	G	12: 31,886,205	T584A	probably benign	Het
Cpa2	T	A	6: 30,547,197	N157K	probably damaging	Het
Cpeb1	A	T	7: 81,351,839	M440K	probably damaging	Het
Cracr2a	G	A	6: 127,604,029	C56Y	probably damaging	Het
Ddb2	A	C	2: 91,236,728	L30R	probably damaging	Het
Dlk1	T	A	12: 109,459,771	I190N	probably damaging	Het
Dnajc13	T	A	9: 104,203,329	Y851F	possibly damaging	Het
Dopey1	T	A	9: 86,515,328	L895Q	probably damaging	Het
Dyx1c1	T	C	9: 72,972,080		probably null	Het
F7	G	A	8: 13,030,763	C122Y	probably damaging	Het
Frrs1	T	C	3: 116,903,100	V573A	possibly damaging	Het
Gm17541	A	T	12: 4,689,672		probably benign	Het
Gm20388	T	C	8: 122,270,436		probably benign	Het
Gm5519	A	T	19: 33,823,176	H90L	probably damaging	Het
Gm5526	T	A	1: 45,857,409		noncoding transcript	Het
Gm5709	A	T	3: 59,602,550		noncoding transcript	Het
Golga4	T	A	9: 118,556,501	V869D	possibly damaging	Het
Grm7	A	T	6: 111,358,221	Q531L	probably benign	Het
Hnrnpu	C	A	1: 178,335,893	C265F	unknown	Het
Hoxd3	G	A	2: 74,746,867	V364I	possibly damaging	Het
Hspb8	T	C	5: 116,409,473	D150G	probably damaging	Het
Hydin	C	A	8: 110,587,223	N4244K	possibly damaging	Het
Ik	A	G	18: 36,748,873	D136G	probably benign	Het
Il11ra1	T	C	4: 41,767,932		probably benign	Het
Jph1	T	C	1: 17,091,398	I347V	probably benign	Het
Klk1	T	A	7: 44,221,561		probably benign	Het
Lmcd1	T	A	6: 112,288,126		probably benign	Het
Lnx1	C	T	5: 74,685,654	C45Y	probably damaging	Het
Macc1	T	A	12: 119,446,529	M344K	possibly damaging	Het
Madcam1	A	G	10: 79,664,945	E32G	possibly damaging	Het
Mat2a	T	C	6: 72,434,333	D383G	probably benign	Het
Mpst	T	A	15: 78,413,649	I289N	probably damaging	Het
Myh6	C	T	14: 54,952,661	R1055Q	probably damaging	Het
Myh7	T	C	14: 54,979,508	K1131E	probably damaging	Het
Ndrg3	A	T	2: 156,931,205		probably benign	Het
Nebl	A	G	2: 17,433,975	S209P	probably benign	Het
Nid2	A	G	14: 19,768,208		probably null	Het
Nup188	A	T	2: 30,330,749	S945C	probably damaging	Het
Olfr1000	C	T	2: 85,608,473	V146I	probably benign	Het
Olfr251	A	G	9: 38,377,917	N12S	probably benign	Het
Olfr50	A	G	2: 36,793,673	M146V	probably benign	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Patl2	A	G	2: 122,128,887	L32P	probably damaging	Het
Pcdh20	T	A	14: 88,468,377	M496L	probably benign	Het
Pfn2	A	G	3: 57,847,391	V31A	probably damaging	Het
Plxna4	T	C	6: 32,251,072	N533S	probably benign	Het
Plxnb1	T	C	9: 109,114,593	F1916S	probably damaging	Het
Ppp4r3b	T	C	11: 29,188,293	F214L	probably benign	Het
Prox1	T	C	1: 190,161,441	D269G	probably benign	Het
Rapgef4	T	C	2: 72,034,034	F71S	probably damaging	Het
Rft1	A	G	14: 30,661,286	I94M	probably benign	Het
S100z	T	C	13: 95,478,619	I13V	probably damaging	Het
Serhl	T	A	15: 83,102,634	V117E	probably damaging	Het
Shroom1	G	A	11: 53,465,507	R336Q	probably benign	Het
Sik3	A	T	9: 46,212,254	Q1067L	probably damaging	Het
Slc22a30	G	A	19: 8,344,393	Q436*	probably null	Het
Slc28a1	G	A	7: 81,122,121	V118M	probably damaging	Het
Slco1a6	T	A	6: 142,132,701	I153F	probably benign	Het
Ss18l1	T	C	2: 180,061,942	Y323H	unknown	Het
Susd4	G	T	1: 182,892,259	A480S	possibly damaging	Het
Syne3	A	T	12: 104,975,880	M1K	probably null	Het
Synpo2l	A	T	14: 20,661,014	S513T	probably benign	Het
Tat	A	T	8: 109,998,334	N388I	probably benign	Het
Tbc1d1	A	G	5: 64,282,009	Y619C	probably damaging	Het
Tbk1	G	A	10: 121,570,685	T216M	probably damaging	Het
Tns1	C	T	1: 73,995,426		probably benign	Het
Trbv5	T	C	6: 41,062,384	V9A	possibly damaging	Het
Trpm5	A	G	7: 143,082,303	Y575H	probably damaging	Het
Ttn	A	T	2: 76,739,701	Y25203*	probably null	Het
Tubb3	C	A	8: 123,421,652	D441E	probably benign	Het
Usp33	T	A	3: 152,391,696	C850*	probably null	Het
Vdac1	G	A	11: 52,384,078		probably null	Het
Vmn1r232	T	C	17: 20,913,584	I251M	probably damaging	Het
Vmn2r11	T	G	5: 109,054,792	I140L	probably benign	Het
Vmn2r6	A	T	3: 64,556,842	N190K	probably benign	Het
Vps51	T	A	19: 6,070,488	H465L	probably benign	Het
Zfp318	T	G	17: 46,412,069	I1666S	probably benign	Het
Zfp446	C	T	7: 12,979,304	R90*	probably null	Het
Zgrf1	T	A	3: 127,602,445	F547I	probably damaging	Het

Other mutations in Pdzd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pdzd2	APN	15	12457983	missense	possibly damaging	0.93
IGL00586:Pdzd2	APN	15	12365767	splice site	probably null
IGL00697:Pdzd2	APN	15	12373647	missense	possibly damaging	0.81
IGL00721:Pdzd2	APN	15	12374412	missense	probably benign	0.00
IGL00971:Pdzd2	APN	15	12374718	missense	probably benign	0.00
IGL01066:Pdzd2	APN	15	12402632	unclassified	probably benign
IGL01389:Pdzd2	APN	15	12374626	missense	possibly damaging	0.56
IGL01505:Pdzd2	APN	15	12458207	missense	probably damaging	1.00
IGL01527:Pdzd2	APN	15	12445664	missense	probably damaging	1.00
IGL01584:Pdzd2	APN	15	12592483	missense	probably damaging	1.00
IGL01763:Pdzd2	APN	15	12372546	missense	probably benign
IGL01915:Pdzd2	APN	15	12371639	missense	probably damaging	1.00
IGL01947:Pdzd2	APN	15	12592354	missense	probably damaging	1.00
IGL02058:Pdzd2	APN	15	12376296	missense	possibly damaging	0.87
IGL02274:Pdzd2	APN	15	12445649	missense	probably damaging	1.00
IGL02408:Pdzd2	APN	15	12375765	missense	probably benign	0.00
IGL02600:Pdzd2	APN	15	12411019	missense	probably damaging	1.00
IGL02637:Pdzd2	APN	15	12385634	missense	probably benign	0.13
IGL02639:Pdzd2	APN	15	12592243	missense	probably damaging	1.00
IGL02712:Pdzd2	APN	15	12376027	missense	probably benign	0.00
IGL02967:Pdzd2	APN	15	12374341	missense	probably benign	0.04
IGL02992:Pdzd2	APN	15	12382622	missense	possibly damaging	0.77
IGL03005:Pdzd2	APN	15	12385265	missense	probably damaging	1.00
IGL03067:Pdzd2	APN	15	12388542	critical splice donor site	probably null
IGL03335:Pdzd2	APN	15	12373764	missense	probably benign	0.00
PIT4280001:Pdzd2	UTSW	15	12399288	missense	probably damaging	1.00
R0022:Pdzd2	UTSW	15	12371605	missense	possibly damaging	0.94
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0241:Pdzd2	UTSW	15	12367941	missense	probably damaging	1.00
R0446:Pdzd2	UTSW	15	12375024	missense	probably benign	0.43
R0462:Pdzd2	UTSW	15	12592160	missense	probably damaging	1.00
R0562:Pdzd2	UTSW	15	12592278	missense	probably damaging	1.00
R0589:Pdzd2	UTSW	15	12376299	missense	probably benign	0.03
R0639:Pdzd2	UTSW	15	12458058	missense	possibly damaging	0.77
R0925:Pdzd2	UTSW	15	12399270	missense	probably damaging	1.00
R1015:Pdzd2	UTSW	15	12374508	missense	probably damaging	1.00
R1054:Pdzd2	UTSW	15	12371639	missense	probably damaging	1.00
R1070:Pdzd2	UTSW	15	12389966	critical splice donor site	probably null
R1099:Pdzd2	UTSW	15	12373087	missense	probably damaging	1.00
R1122:Pdzd2	UTSW	15	12457895	missense	probably benign	0.25
R1126:Pdzd2	UTSW	15	12458220	missense	possibly damaging	0.94
R1381:Pdzd2	UTSW	15	12385439	missense	probably benign	0.02
R1385:Pdzd2	UTSW	15	12411022	missense	probably benign	0.38
R1513:Pdzd2	UTSW	15	12373829	missense	possibly damaging	0.88
R1538:Pdzd2	UTSW	15	12372961	missense	probably damaging	1.00
R1750:Pdzd2	UTSW	15	12385864	missense	probably damaging	1.00
R1775:Pdzd2	UTSW	15	12592460	missense	probably damaging	1.00
R1801:Pdzd2	UTSW	15	12387654	missense	possibly damaging	0.56
R1832:Pdzd2	UTSW	15	12390048	missense	probably damaging	1.00
R1856:Pdzd2	UTSW	15	12373855	missense	possibly damaging	0.87
R1870:Pdzd2	UTSW	15	12457886	missense	probably damaging	1.00
R1879:Pdzd2	UTSW	15	12373900	missense	possibly damaging	0.61
R2072:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2073:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2075:Pdzd2	UTSW	15	12385819	missense	probably damaging	1.00
R2125:Pdzd2	UTSW	15	12373590	missense	probably benign	0.37
R2142:Pdzd2	UTSW	15	12406559	missense	probably damaging	1.00
R2155:Pdzd2	UTSW	15	12375793	missense	probably benign	0.43
R2282:Pdzd2	UTSW	15	12373848	missense	possibly damaging	0.95
R2407:Pdzd2	UTSW	15	12373161	missense	probably damaging	1.00
R3545:Pdzd2	UTSW	15	12375471	missense	probably benign	0.00
R3878:Pdzd2	UTSW	15	12376176	missense	probably benign	0.00
R3879:Pdzd2	UTSW	15	12375508	missense	probably damaging	1.00
R4396:Pdzd2	UTSW	15	12387646	missense	probably benign	0.36
R4398:Pdzd2	UTSW	15	12375975	missense	probably benign	0.30
R4491:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12385637	missense	possibly damaging	0.75
R4492:Pdzd2	UTSW	15	12419481	missense	possibly damaging	0.48
R4656:Pdzd2	UTSW	15	12385711	missense	probably benign	0.00
R4715:Pdzd2	UTSW	15	12419516	missense	possibly damaging	0.72
R4803:Pdzd2	UTSW	15	12374595	missense	probably benign	0.04
R4893:Pdzd2	UTSW	15	12385343	missense	probably benign	0.00
R4959:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R4973:Pdzd2	UTSW	15	12375648	missense	probably damaging	1.00
R5030:Pdzd2	UTSW	15	12592408	nonsense	probably null
R5174:Pdzd2	UTSW	15	12372514	missense	probably benign	0.01
R5230:Pdzd2	UTSW	15	12390033	missense	probably damaging	1.00
R5268:Pdzd2	UTSW	15	12592177	missense	probably damaging	1.00
R5488:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5489:Pdzd2	UTSW	15	12382676	missense	probably benign	0.00
R5588:Pdzd2	UTSW	15	12374281	missense	possibly damaging	0.48
R5605:Pdzd2	UTSW	15	12592350	nonsense	probably null
R5704:Pdzd2	UTSW	15	12385675	missense	probably benign	0.02
R5858:Pdzd2	UTSW	15	12442589	missense	probably damaging	0.97
R6048:Pdzd2	UTSW	15	12592570	splice site	probably null
R6222:Pdzd2	UTSW	15	12374566	missense	probably damaging	1.00
R6311:Pdzd2	UTSW	15	12458188	missense	probably damaging	1.00
R6734:Pdzd2	UTSW	15	12592465	missense	probably damaging	1.00
R6897:Pdzd2	UTSW	15	12385865	missense	probably damaging	1.00
R6900:Pdzd2	UTSW	15	12374037	missense	probably benign
R6955:Pdzd2	UTSW	15	12401464	missense	probably damaging	1.00
R6959:Pdzd2	UTSW	15	12375907	missense	probably benign	0.17
R6992:Pdzd2	UTSW	15	12457859	missense	probably damaging	1.00
R7014:Pdzd2	UTSW	15	12372561	missense	probably benign	0.13
R7014:Pdzd2	UTSW	15	12372975	missense	probably benign	0.14
R7110:Pdzd2	UTSW	15	12368013	missense	probably damaging	1.00
R7180:Pdzd2	UTSW	15	12376123	missense	probably damaging	0.99
R7228:Pdzd2	UTSW	15	12372973	missense	probably benign	0.01
R7228:Pdzd2	UTSW	15	12458145	nonsense	probably null
R7317:Pdzd2	UTSW	15	12592243	missense	probably damaging	1.00
R7322:Pdzd2	UTSW	15	12437162	missense	probably damaging	1.00
R7349:Pdzd2	UTSW	15	12399205	missense	probably damaging	1.00
R7600:Pdzd2	UTSW	15	12372734	missense	probably damaging	1.00
R7663:Pdzd2	UTSW	15	12373203	missense	probably damaging	1.00
R7712:Pdzd2	UTSW	15	12407336	missense	probably damaging	1.00
R7716:Pdzd2	UTSW	15	12373374	missense	possibly damaging	0.63
R7740:Pdzd2	UTSW	15	12374016	missense	probably benign	0.00
R7748:Pdzd2	UTSW	15	12385786	missense	possibly damaging	0.60
R8017:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8019:Pdzd2	UTSW	15	12373036	missense	probably damaging	1.00
R8108:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8109:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8110:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8111:Pdzd2	UTSW	15	12373506	missense	probably benign	0.01
R8145:Pdzd2	UTSW	15	12407372	missense	probably benign	0.37
R8220:Pdzd2	UTSW	15	12592163	missense	probably damaging	0.99
R8278:Pdzd2	UTSW	15	12375909	missense	probably benign
R8768:Pdzd2	UTSW	15	12437166	missense	probably damaging	1.00
R8879:Pdzd2	UTSW	15	12402319	missense	probably damaging	1.00
R9019:Pdzd2	UTSW	15	12375526	missense	probably damaging	1.00
R9030:Pdzd2	UTSW	15	12374299	missense	probably benign	0.02
R9061:Pdzd2	UTSW	15	12374667	missense	possibly damaging	0.94
R9302:Pdzd2	UTSW	15	12374256	missense	possibly damaging	0.61
R9321:Pdzd2	UTSW	15	12385937	missense	probably benign	0.00
R9421:Pdzd2	UTSW	15	12375028	missense
R9515:Pdzd2	UTSW	15	12374535	missense	probably damaging	1.00
R9592:Pdzd2	UTSW	15	12458020	missense	probably damaging	1.00
R9614:Pdzd2	UTSW	15	12375400	missense	probably damaging	1.00
R9630:Pdzd2	UTSW	15	12374357	missense	probably benign	0.37
R9776:Pdzd2	UTSW	15	12457823	missense	probably benign	0.03
X0057:Pdzd2	UTSW	15	12411027	missense	probably damaging	1.00
X0063:Pdzd2	UTSW	15	12368719	missense	possibly damaging	0.77
X0066:Pdzd2	UTSW	15	12372856	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTACACAGCTTGTCCAGGTC -3'
(R):5'- TTATCCGTGAGCTCCAAGC -3'

Sequencing Primer
(F):5'- ATGCTCAAGGCTCTCAGC -3'
(R):5'- GCCTCCCGTTAACAGACG -3'

Posted On

2016-07-06