Incidental Mutation 'R5180:Pigb'
ID399729
Institutional Source Beutler Lab
Gene Symbol Pigb
Ensembl Gene ENSMUSG00000079469
Gene Namephosphatidylinositol glycan anchor biosynthesis, class B
Synonyms
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.864) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location73007419-73040378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 73034590 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 129 (I129N)
Ref Sequence ENSEMBL: ENSMUSP00000139076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098566] [ENSMUST00000183746] [ENSMUST00000184035] [ENSMUST00000184389]
Predicted Effect probably damaging
Transcript: ENSMUST00000098566
AA Change: I129N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096165
Gene: ENSMUSG00000079469
AA Change: I129N

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 4.7e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183587
Predicted Effect probably damaging
Transcript: ENSMUST00000183746
AA Change: I129N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138885
Gene: ENSMUSG00000079469
AA Change: I129N

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000183904
AA Change: D24E
Predicted Effect probably damaging
Transcript: ENSMUST00000184035
AA Change: I129N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139269
Gene: ENSMUSG00000079469
AA Change: I129N

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184389
AA Change: I129N

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139076
Gene: ENSMUSG00000079469
AA Change: I129N

DomainStartEndE-ValueType
Pfam:Glyco_transf_22 51 438 3.9e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185027
Meta Mutation Damage Score 0.9231 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that is located in the endoplasmic reticulum and is involved in GPI-anchor biosynthesis. The glycosylphosphatidylinositol (GPI) anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This gene is thought to encode a member of a family of dolichol-phosphate-mannose (Dol-P-Man) dependent mannosyltransferases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Pigb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Pigb APN 9 73022291 missense probably damaging 0.98
IGL01792:Pigb APN 9 73017986 missense probably damaging 1.00
IGL02416:Pigb APN 9 73017432 missense probably benign 0.00
R2396:Pigb UTSW 9 73015271 nonsense probably null
R2914:Pigb UTSW 9 73039778 splice site probably null
R3830:Pigb UTSW 9 73017473 missense probably benign 0.03
R5048:Pigb UTSW 9 73029708 critical splice acceptor site probably null
R5158:Pigb UTSW 9 73022401 missense probably damaging 1.00
R5385:Pigb UTSW 9 73039545 missense probably benign 0.05
R5866:Pigb UTSW 9 73029684 missense probably damaging 1.00
R7460:Pigb UTSW 9 73038675 missense probably damaging 0.99
R7552:Pigb UTSW 9 73034488 missense probably benign 0.30
R8005:Pigb UTSW 9 73015264 missense unknown
R8136:Pigb UTSW 9 73022320 missense possibly damaging 0.77
Z1176:Pigb UTSW 9 73034572 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGTTTATCCCACACATGCG -3'
(R):5'- CCTACGATTACAAAAGGTGAACG -3'

Sequencing Primer
(F):5'- GTGTTTATCCCACACATGCGATACAC -3'
(R):5'- AATCCCCAGTACTTGGTGCTGAG -3'
Posted On2016-07-06