Incidental Mutation 'R5180:Kif15'
Institutional Source Beutler Lab
Gene Symbol Kif15
Ensembl Gene ENSMUSG00000036768
Gene Namekinesin family member 15
SynonymsHKLP2, Knsl7, N-10 kinesin
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosomal Location122951046-123018733 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122999210 bp
Amino Acid Change Cysteine to Tyrosine at position 634 (C634Y)
Ref Sequence ENSEMBL: ENSMUSP00000150678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040717] [ENSMUST00000214652]
Predicted Effect probably damaging
Transcript: ENSMUST00000040717
AA Change: C862Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035490
Gene: ENSMUSG00000036768
AA Change: C862Y

KISc 24 371 2.86e-179 SMART
Pfam:Kinesin-relat_1 463 551 6.6e-26 PFAM
coiled coil region 579 643 N/A INTRINSIC
coiled coil region 706 1037 N/A INTRINSIC
coiled coil region 1065 1133 N/A INTRINSIC
Pfam:HMMR_C 1265 1387 3.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214183
Predicted Effect probably damaging
Transcript: ENSMUST00000214652
AA Change: C634Y

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Meta Mutation Damage Score 0.0692 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Kif15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Kif15 APN 9 122975755 missense probably damaging 1.00
IGL01577:Kif15 APN 9 122996334 missense probably benign 0.06
IGL01647:Kif15 APN 9 122963471 intron probably benign
IGL01921:Kif15 APN 9 122979504 missense probably damaging 1.00
IGL02040:Kif15 APN 9 123017385 missense probably damaging 0.99
IGL02191:Kif15 APN 9 122975679 missense probably damaging 1.00
IGL02218:Kif15 APN 9 122995827 splice site probably benign
IGL02537:Kif15 APN 9 122993849 missense probably benign 0.08
IGL02814:Kif15 APN 9 123003640 missense possibly damaging 0.83
PIT4480001:Kif15 UTSW 9 123011543 missense probably benign
R0034:Kif15 UTSW 9 122999285 missense possibly damaging 0.47
R0458:Kif15 UTSW 9 123009359 missense probably benign
R0526:Kif15 UTSW 9 122997797 missense probably damaging 0.96
R0533:Kif15 UTSW 9 123009433 unclassified probably benign
R0726:Kif15 UTSW 9 122959928 missense probably benign 0.21
R1580:Kif15 UTSW 9 122959956 missense probably benign 0.22
R1597:Kif15 UTSW 9 122994009 missense probably benign 0.22
R2096:Kif15 UTSW 9 122986187 missense probably damaging 1.00
R3125:Kif15 UTSW 9 122987961 missense probably damaging 0.99
R3176:Kif15 UTSW 9 122987840 splice site probably benign
R4088:Kif15 UTSW 9 122986189 missense probably benign 0.29
R4308:Kif15 UTSW 9 123013982 missense probably benign 0.00
R4597:Kif15 UTSW 9 122993849 missense probably benign 0.08
R4705:Kif15 UTSW 9 122959993 splice site probably null
R4832:Kif15 UTSW 9 123002126 splice site probably null
R5100:Kif15 UTSW 9 122991994 missense probably damaging 0.98
R5126:Kif15 UTSW 9 122975758 missense probably damaging 1.00
R5247:Kif15 UTSW 9 122986442 missense possibly damaging 0.65
R5376:Kif15 UTSW 9 122993971 missense probably benign 0.04
R5392:Kif15 UTSW 9 122996295 missense probably damaging 0.99
R5422:Kif15 UTSW 9 122984889 splice site probably null
R5562:Kif15 UTSW 9 122978016 missense probably damaging 1.00
R5663:Kif15 UTSW 9 122991851 splice site probably null
R5767:Kif15 UTSW 9 123013974 missense possibly damaging 0.78
R5927:Kif15 UTSW 9 123017261 missense probably benign 0.00
R6049:Kif15 UTSW 9 123011622 missense probably damaging 0.98
R6435:Kif15 UTSW 9 122986491 missense probably damaging 1.00
R7040:Kif15 UTSW 9 123011614 missense possibly damaging 0.67
R7158:Kif15 UTSW 9 122999314 missense probably benign
R7163:Kif15 UTSW 9 123017657 missense probably damaging 1.00
R7197:Kif15 UTSW 9 123009926 critical splice donor site probably null
R7318:Kif15 UTSW 9 122987949 missense probably damaging 1.00
R7360:Kif15 UTSW 9 122991137 missense probably benign
R8039:Kif15 UTSW 9 123007425 missense possibly damaging 0.82
R8228:Kif15 UTSW 9 122991976 missense possibly damaging 0.82
Z1177:Kif15 UTSW 9 122951051 unclassified probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-07-06