Incidental Mutation 'R5180:Gm5134'
ID399738
Institutional Source Beutler Lab
Gene Symbol Gm5134
Ensembl Gene ENSMUSG00000033255
Gene Namepredicted gene 5134
Synonyms
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75954514-76009591 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75976366 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 152 (Y152H)
Ref Sequence ENSEMBL: ENSMUSP00000097172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099577]
Predicted Effect probably damaging
Transcript: ENSMUST00000099577
AA Change: Y152H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097172
Gene: ENSMUSG00000033255
AA Change: Y152H

DomainStartEndE-ValueType
Pfam:SSF 32 466 2.9e-119 PFAM
transmembrane domain 500 522 N/A INTRINSIC
transmembrane domain 651 670 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134234
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Gm5134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00941:Gm5134 APN 10 76000421 missense possibly damaging 0.70
IGL01371:Gm5134 APN 10 76004747 missense probably damaging 0.99
IGL02140:Gm5134 APN 10 75986111 missense probably benign 0.03
IGL02197:Gm5134 APN 10 75954702 critical splice donor site probably null
IGL02233:Gm5134 APN 10 76008500 critical splice acceptor site probably null
IGL02612:Gm5134 APN 10 75992489 missense probably damaging 1.00
IGL02896:Gm5134 APN 10 75974224 missense possibly damaging 0.82
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0021:Gm5134 UTSW 10 75993884 missense probably damaging 1.00
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0035:Gm5134 UTSW 10 75993864 missense probably benign 0.01
R0110:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R0499:Gm5134 UTSW 10 75992525 missense probably benign 0.00
R0510:Gm5134 UTSW 10 75974245 missense probably benign 0.03
R1429:Gm5134 UTSW 10 75978381 missense probably damaging 1.00
R1726:Gm5134 UTSW 10 75992527 missense possibly damaging 0.83
R1918:Gm5134 UTSW 10 75976346 missense possibly damaging 0.70
R1956:Gm5134 UTSW 10 76004846 missense possibly damaging 0.89
R1993:Gm5134 UTSW 10 75966393 missense probably damaging 0.96
R2049:Gm5134 UTSW 10 76004884 missense possibly damaging 0.92
R2188:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R3551:Gm5134 UTSW 10 76000447 missense probably benign 0.08
R4074:Gm5134 UTSW 10 76008531 missense probably damaging 1.00
R4435:Gm5134 UTSW 10 75995824 missense probably damaging 1.00
R4466:Gm5134 UTSW 10 76008575 missense probably benign 0.00
R5446:Gm5134 UTSW 10 75995836 missense probably damaging 1.00
R5601:Gm5134 UTSW 10 75985952 missense probably damaging 0.98
R5627:Gm5134 UTSW 10 75986108 missense possibly damaging 0.93
R5777:Gm5134 UTSW 10 76004760 missense probably benign 0.00
R5867:Gm5134 UTSW 10 76008616 missense probably benign 0.00
R6145:Gm5134 UTSW 10 75995839 missense probably damaging 0.99
R6232:Gm5134 UTSW 10 75986025 missense possibly damaging 0.95
R6271:Gm5134 UTSW 10 75995809 missense probably benign 0.32
R6329:Gm5134 UTSW 10 75954660 missense possibly damaging 0.68
R6723:Gm5134 UTSW 10 76008619 missense probably benign
R7049:Gm5134 UTSW 10 75992458 missense probably damaging 0.97
R7305:Gm5134 UTSW 10 76000399 missense probably damaging 1.00
R7579:Gm5134 UTSW 10 75964437 missense probably damaging 1.00
X0050:Gm5134 UTSW 10 75992510 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGATGTCTGAGGCCCTAG -3'
(R):5'- AGAGGTACCTCCGACCATTATTC -3'

Sequencing Primer
(F):5'- TGGGTCCATAGCTTCACACAG -3'
(R):5'- CTTCGTGACATCTACAGACTTGGG -3'
Posted On2016-07-06