Incidental Mutation 'R5180:Irak3'
ID399742
Institutional Source Beutler Lab
Gene Symbol Irak3
Ensembl Gene ENSMUSG00000020227
Gene Nameinterleukin-1 receptor-associated kinase 3
Synonyms4833428C18Rik, IRAK-M
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.444) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location120141648-120202130 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120145782 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 406 (K406T)
Ref Sequence ENSEMBL: ENSMUSP00000020448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020448] [ENSMUST00000135106] [ENSMUST00000145665]
Predicted Effect probably damaging
Transcript: ENSMUST00000020448
AA Change: K406T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020448
Gene: ENSMUSG00000020227
AA Change: K406T

DomainStartEndE-ValueType
Pfam:Death 26 106 1.3e-15 PFAM
Pfam:Pkinase 178 456 8.4e-37 PFAM
Pfam:Pkinase_Tyr 178 456 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135106
SMART Domains Protein: ENSMUSP00000123604
Gene: ENSMUSG00000020227

DomainStartEndE-ValueType
Pfam:Death 26 106 2.2e-16 PFAM
Pfam:Pkinase_Tyr 178 301 3.1e-15 PFAM
Pfam:Pkinase 178 302 4.9e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145665
AA Change: K314T

PolyPhen 2 Score 0.124 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118038
Gene: ENSMUSG00000020227
AA Change: K314T

DomainStartEndE-ValueType
Pfam:Pkinase 86 364 8.4e-35 PFAM
Pfam:Pkinase_Tyr 86 364 1.7e-34 PFAM
Meta Mutation Damage Score 0.2036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the interleukin-1 receptor-associated kinase protein family. Members of this family are essential components of the Toll/IL-R immune signal transduction pathways. This protein is primarily expressed in monocytes and macrophages and functions as a negative regulator of Toll-like receptor signaling. Mutations in this gene are associated with a susceptibility to asthma. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormal inflammatory responses to bacterial infections and loose bone mass with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Irak3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Irak3 APN 10 120178067 critical splice donor site probably null
IGL01015:Irak3 APN 10 120142790 nonsense probably null
IGL01530:Irak3 APN 10 120142794 missense probably benign 0.10
IGL01641:Irak3 APN 10 120176347 missense probably benign 0.35
IGL01730:Irak3 APN 10 120178100 missense probably benign 0.04
IGL02054:Irak3 APN 10 120176259 missense probably benign 0.01
IGL02938:Irak3 APN 10 120182524 critical splice donor site probably null
IGL02954:Irak3 APN 10 120176242 missense probably damaging 0.98
IGL02992:Irak3 APN 10 120182661 missense probably damaging 1.00
IGL03376:Irak3 APN 10 120146636 splice site probably benign
iracema UTSW 10 120145782 missense probably damaging 0.99
R0031:Irak3 UTSW 10 120176320 nonsense probably null
R0734:Irak3 UTSW 10 120145637 splice site probably benign
R1017:Irak3 UTSW 10 120142884 missense possibly damaging 0.94
R1025:Irak3 UTSW 10 120176346 missense probably damaging 1.00
R1486:Irak3 UTSW 10 120143061 missense probably damaging 1.00
R1538:Irak3 UTSW 10 120165130 missense probably benign 0.00
R1596:Irak3 UTSW 10 120182546 missense probably damaging 1.00
R1689:Irak3 UTSW 10 120146552 missense probably damaging 0.98
R2133:Irak3 UTSW 10 120165177 missense probably benign 0.10
R3609:Irak3 UTSW 10 120145677 missense possibly damaging 0.95
R3947:Irak3 UTSW 10 120170373 missense probably benign 0.00
R3948:Irak3 UTSW 10 120170373 missense probably benign 0.00
R4510:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4511:Irak3 UTSW 10 120145908 missense probably damaging 0.99
R4885:Irak3 UTSW 10 120182681 missense probably damaging 1.00
R5007:Irak3 UTSW 10 120146429 critical splice donor site probably null
R5704:Irak3 UTSW 10 120145689 missense probably benign 0.04
R5715:Irak3 UTSW 10 120142736 missense possibly damaging 0.66
R6020:Irak3 UTSW 10 120143137 missense probably damaging 1.00
R6916:Irak3 UTSW 10 120201365 missense probably damaging 1.00
R7182:Irak3 UTSW 10 120166511 missense probably damaging 1.00
R7707:Irak3 UTSW 10 120146584 missense probably damaging 0.99
R7787:Irak3 UTSW 10 120176351 missense probably benign 0.06
R8087:Irak3 UTSW 10 120182535 missense probably benign 0.02
X0023:Irak3 UTSW 10 120143187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGATTCCCCATGGCTC -3'
(R):5'- CAACTTCTGTGGCTGACTTGG -3'

Sequencing Primer
(F):5'- CATGGCTCGTCTTTCAATAAAACC -3'
(R):5'- CGTAGGTGATCATGGAGGTTCTAAC -3'
Posted On2016-07-06