Incidental Mutation 'R5257:Kyat3'
ID399747
Institutional Source Beutler Lab
Gene Symbol Kyat3
Ensembl Gene ENSMUSG00000040213
Gene Namekynurenine aminotransferase 3
SynonymsKat3, KATIII, Ccbl2
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location142701051-142746870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142734576 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 354 (M354V)
Ref Sequence ENSEMBL: ENSMUSP00000101825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044392] [ENSMUST00000106218] [ENSMUST00000129775]
Predicted Effect probably benign
Transcript: ENSMUST00000044392
AA Change: M319V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000041675
Gene: ENSMUSG00000040213
AA Change: M319V

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 29 411 5.8e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106218
AA Change: M354V

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101825
Gene: ENSMUSG00000040213
AA Change: M354V

DomainStartEndE-ValueType
Pfam:Aminotran_1_2 64 446 4.8e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128096
Predicted Effect probably benign
Transcript: ENSMUST00000129775
SMART Domains Protein: ENSMUSP00000121687
Gene: ENSMUSG00000040213

DomainStartEndE-ValueType
PDB:3E2Z|B 7 69 3e-37 PDB
SCOP:d1gdea_ 8 70 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137623
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198957
Meta Mutation Damage Score 0.2616 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an aminotransferase that transaminates kynurenine to form kynurenic acid, which is a metabolite of tryptophan. Multiple alternatively spliced transcript variants that encode different proteins have been described for this gene. This gene shares 5' exon structure with the RNA binding motif protein, X-linked-like 1 locus on chromosome 1, but the coding sequences are non-overlapping. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Kyat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Kyat3 APN 3 142734474 missense probably benign 0.25
IGL00228:Kyat3 APN 3 142726257 missense probably damaging 1.00
IGL02065:Kyat3 APN 3 142720375 missense probably benign 0.07
IGL02529:Kyat3 APN 3 142720474 missense probably benign
IGL02665:Kyat3 APN 3 142734466 splice site probably null
IGL03399:Kyat3 APN 3 142726010 missense probably damaging 0.99
R1013:Kyat3 UTSW 3 142726246 missense probably damaging 0.97
R1180:Kyat3 UTSW 3 142737770 critical splice acceptor site probably null
R1181:Kyat3 UTSW 3 142737770 critical splice acceptor site probably null
R1236:Kyat3 UTSW 3 142738259 missense probably benign
R1826:Kyat3 UTSW 3 142723179 missense possibly damaging 0.86
R3792:Kyat3 UTSW 3 142737844 missense probably null 0.29
R4165:Kyat3 UTSW 3 142726305 splice site probably null
R4332:Kyat3 UTSW 3 142725426 missense probably damaging 1.00
R4353:Kyat3 UTSW 3 142731293 critical splice donor site probably null
R5396:Kyat3 UTSW 3 142734606 missense probably benign 0.03
R5687:Kyat3 UTSW 3 142734582 missense probably null 0.00
R5933:Kyat3 UTSW 3 142723260 missense probably damaging 1.00
R6374:Kyat3 UTSW 3 142738237 missense probably damaging 1.00
R6537:Kyat3 UTSW 3 142729812 missense probably benign 0.12
R6938:Kyat3 UTSW 3 142725422 missense probably damaging 1.00
R7092:Kyat3 UTSW 3 142729795 missense probably damaging 1.00
R7176:Kyat3 UTSW 3 142737839 missense possibly damaging 0.73
R7203:Kyat3 UTSW 3 142720401 missense probably damaging 0.97
R7252:Kyat3 UTSW 3 142720458 missense probably benign 0.05
R7487:Kyat3 UTSW 3 142726194 nonsense probably null
R7522:Kyat3 UTSW 3 142734544 missense probably damaging 1.00
R7729:Kyat3 UTSW 3 142726305 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGGCTGTAATTGACCGAGTGAC -3'
(R):5'- AGATGAGATGCAGTTCTGGC -3'

Sequencing Primer
(F):5'- GACCGAGTGACTTCTTGACAC -3'
(R):5'- AGATGCAGTTCTGGCTTTGGC -3'
Posted On2016-07-06