Incidental Mutation 'R5257:Prdm16'
ID399755
Institutional Source Beutler Lab
Gene Symbol Prdm16
Ensembl Gene ENSMUSG00000039410
Gene NamePR domain containing 16
SynonymsMel1, 5730557K01Rik, csp1, line 27
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.599) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location154316125-154636873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 154367214 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 179 (D179E)
Ref Sequence ENSEMBL: ENSMUSP00000095365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030902] [ENSMUST00000070313] [ENSMUST00000097759] [ENSMUST00000105636] [ENSMUST00000105637] [ENSMUST00000105638] [ENSMUST00000124771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030902
AA Change: D179E

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030902
Gene: ENSMUSG00000039410
AA Change: D179E

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 951 973 5.29e-5 SMART
ZnF_C2H2 979 1002 1.6e-4 SMART
ZnF_C2H2 1008 1030 7.26e-3 SMART
low complexity region 1116 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070313
AA Change: D180E

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000064546
Gene: ENSMUSG00000039410
AA Change: D180E

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 953 975 5.29e-5 SMART
ZnF_C2H2 981 1004 1.6e-4 SMART
ZnF_C2H2 1010 1032 7.26e-3 SMART
low complexity region 1118 1134 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097759
AA Change: D179E

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095365
Gene: ENSMUSG00000039410
AA Change: D179E

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105636
AA Change: D180E

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000101261
Gene: ENSMUSG00000039410
AA Change: D180E

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 218 8.75e-5 SMART
ZnF_C2H2 231 251 2.82e1 SMART
low complexity region 261 275 N/A INTRINSIC
ZnF_C2H2 283 305 1.04e-3 SMART
ZnF_C2H2 311 333 1.6e-4 SMART
ZnF_C2H2 339 362 3.95e-4 SMART
ZnF_C2H2 368 390 1.95e-3 SMART
ZnF_C2H2 396 418 8.22e-2 SMART
ZnF_C2H2 425 452 9.96e0 SMART
low complexity region 497 518 N/A INTRINSIC
low complexity region 521 541 N/A INTRINSIC
low complexity region 611 642 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105637
AA Change: D178E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101262
Gene: ENSMUSG00000039410
AA Change: D178E

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 216 8.75e-5 SMART
ZnF_C2H2 229 249 2.82e1 SMART
low complexity region 259 273 N/A INTRINSIC
ZnF_C2H2 281 303 1.04e-3 SMART
ZnF_C2H2 309 331 1.6e-4 SMART
ZnF_C2H2 337 360 3.95e-4 SMART
ZnF_C2H2 366 388 1.95e-3 SMART
ZnF_C2H2 394 416 8.22e-2 SMART
ZnF_C2H2 423 450 9.96e0 SMART
low complexity region 495 516 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 609 640 N/A INTRINSIC
ZnF_C2H2 950 972 5.29e-5 SMART
ZnF_C2H2 978 1001 1.6e-4 SMART
ZnF_C2H2 1007 1029 7.26e-3 SMART
low complexity region 1115 1131 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105638
AA Change: D179E

PolyPhen 2 Score 0.478 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101263
Gene: ENSMUSG00000039410
AA Change: D179E

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 217 8.75e-5 SMART
ZnF_C2H2 230 250 2.82e1 SMART
low complexity region 260 274 N/A INTRINSIC
ZnF_C2H2 282 304 1.04e-3 SMART
ZnF_C2H2 310 332 1.6e-4 SMART
ZnF_C2H2 338 361 3.95e-4 SMART
ZnF_C2H2 367 389 1.95e-3 SMART
ZnF_C2H2 395 417 8.22e-2 SMART
ZnF_C2H2 424 451 9.96e0 SMART
low complexity region 496 517 N/A INTRINSIC
low complexity region 520 540 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
ZnF_C2H2 952 974 5.29e-5 SMART
ZnF_C2H2 980 1003 1.6e-4 SMART
ZnF_C2H2 1009 1031 7.26e-3 SMART
low complexity region 1117 1133 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000124771
AA Change: D178E

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117598
Gene: ENSMUSG00000039410
AA Change: D178E

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 74 83 N/A INTRINSIC
SET 84 213 8.04e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141164
Meta Mutation Damage Score 0.2346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The reciprocal translocation t(1;3)(p36;q21) occurs in a subset of myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). This gene is located near the 1p36.3 breakpoint and has been shown to be specifically expressed in the t(1:3)(p36,q21)-positive MDS/AML. The protein encoded by this gene is a zinc finger transcription factor and contains an N-terminal PR domain. The translocation results in the overexpression of a truncated version of this protein that lacks the PR domain, which may play an important role in the pathogenesis of MDS and AML. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice exhibit a cleft secondary palate, whitening of brown adipose tissue in older or fed a high-fat diet, and impaired adaptive thermogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Prdm16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Prdm16 APN 4 154341969 missense possibly damaging 0.89
IGL01517:Prdm16 APN 4 154328425 missense probably damaging 1.00
IGL01810:Prdm16 APN 4 154347927 missense probably benign 0.10
IGL02260:Prdm16 APN 4 154328287 missense probably benign 0.00
IGL02623:Prdm16 APN 4 154340877 missense probably damaging 0.98
IGL02744:Prdm16 APN 4 154345453 missense probably damaging 1.00
R0126:Prdm16 UTSW 4 154328838 splice site probably benign
R0345:Prdm16 UTSW 4 154341111 missense probably benign 0.09
R0365:Prdm16 UTSW 4 154342056 missense probably damaging 1.00
R0440:Prdm16 UTSW 4 154476627 splice site probably benign
R0899:Prdm16 UTSW 4 154528909 missense probably damaging 1.00
R1127:Prdm16 UTSW 4 154528799 missense probably damaging 1.00
R1546:Prdm16 UTSW 4 154528660 missense possibly damaging 0.94
R1803:Prdm16 UTSW 4 154335261 missense probably damaging 1.00
R2117:Prdm16 UTSW 4 154347925 missense probably null 0.99
R3814:Prdm16 UTSW 4 154328293 missense probably damaging 1.00
R4348:Prdm16 UTSW 4 154476667 missense probably benign 0.00
R4458:Prdm16 UTSW 4 154322308 missense probably benign
R4557:Prdm16 UTSW 4 154528827 missense probably benign 0.01
R4581:Prdm16 UTSW 4 154323353 missense probably damaging 1.00
R4584:Prdm16 UTSW 4 154337683 missense probably damaging 1.00
R4627:Prdm16 UTSW 4 154367240 missense probably damaging 1.00
R4926:Prdm16 UTSW 4 154341552 missense possibly damaging 0.74
R5055:Prdm16 UTSW 4 154335262 missense possibly damaging 0.48
R5152:Prdm16 UTSW 4 154346102 missense probably damaging 0.99
R5258:Prdm16 UTSW 4 154367214 missense possibly damaging 0.89
R5368:Prdm16 UTSW 4 154345391 missense probably damaging 1.00
R5464:Prdm16 UTSW 4 154346144 critical splice acceptor site probably null
R5640:Prdm16 UTSW 4 154341910 missense probably benign
R5744:Prdm16 UTSW 4 154528704 missense probably damaging 1.00
R5892:Prdm16 UTSW 4 154323259 missense possibly damaging 0.74
R5938:Prdm16 UTSW 4 154347954 missense probably damaging 0.99
R6380:Prdm16 UTSW 4 154341367 missense probably benign 0.00
R6784:Prdm16 UTSW 4 154323307 missense probably damaging 1.00
R7097:Prdm16 UTSW 4 154345468 missense probably damaging 1.00
R7181:Prdm16 UTSW 4 154528637 missense probably damaging 1.00
R7197:Prdm16 UTSW 4 154341510 missense probably damaging 1.00
R7273:Prdm16 UTSW 4 154345453 missense probably damaging 1.00
R7379:Prdm16 UTSW 4 154528859 missense probably damaging 1.00
R7641:Prdm16 UTSW 4 154345444 missense probably damaging 1.00
R7704:Prdm16 UTSW 4 154341490 missense probably damaging 1.00
R7751:Prdm16 UTSW 4 154328299 missense probably damaging 1.00
R8048:Prdm16 UTSW 4 154320882 missense probably damaging 1.00
RF008:Prdm16 UTSW 4 154341995 missense probably damaging 1.00
X0010:Prdm16 UTSW 4 154323377 missense probably damaging 1.00
Z1176:Prdm16 UTSW 4 154341786 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GTCAAATGGCTACCCCTTGTG -3'
(R):5'- AGGTCTTAGACAACCTGCCATC -3'

Sequencing Primer
(F):5'- CTTGTGGCAGGACAGAGCTTAG -3'
(R):5'- TTAGACAACCTGCCATCCTGCC -3'
Posted On2016-07-06