Incidental Mutation 'R5257:P2rx7'
List |< first << previous [record 33 of 56] next >> last >|
ID399757
Institutional Source Beutler Lab
Gene Symbol P2rx7
Ensembl Gene ENSMUSG00000029468
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 7
SynonymsP2X7R, P2X7 receptor, P2X(7)
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location122643911-122691432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122681003 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 496 (E496G)
Ref Sequence ENSEMBL: ENSMUSP00000098303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031425] [ENSMUST00000100737] [ENSMUST00000121489]
Predicted Effect probably benign
Transcript: ENSMUST00000031425
SMART Domains Protein: ENSMUSP00000031425
Gene: ENSMUSG00000029468

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 1e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100737
AA Change: E496G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000098303
Gene: ENSMUSG00000029468
AA Change: E496G

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 397 3.6e-158 PFAM
low complexity region 435 451 N/A INTRINSIC
low complexity region 516 536 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121489
SMART Domains Protein: ENSMUSP00000112440
Gene: ENSMUSG00000029468

DomainStartEndE-ValueType
Pfam:P2X_receptor 11 403 3.5e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199371
Meta Mutation Damage Score 0.1961 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel and is responsible for ATP-dependent lysis of macrophages through the formation of membrane pores permeable to large molecules. Activation of this nuclear receptor by ATP in the cytoplasm may be a mechanism by which cellular activity can be coupled to changes in gene expression. Multiple alternatively spliced variants have been identified, most of which fit nonsense-mediated decay (NMD) criteria. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are fertile and viable with no obvious phenotypic abnormality. Cellular responses of macrophages to extracellular ATP are frequently normal however. In addition, long bones are thinner than normal in adult mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in P2rx7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:P2rx7 APN 5 122676698 missense probably damaging 1.00
IGL01911:P2rx7 APN 5 122658768 missense probably damaging 0.99
IGL02375:P2rx7 APN 5 122673656 splice site probably benign
IGL02502:P2rx7 APN 5 122680987 missense possibly damaging 0.92
IGL03102:P2rx7 APN 5 122663605 missense possibly damaging 0.88
IGL03179:P2rx7 APN 5 122673700 missense possibly damaging 0.66
ailing UTSW 5 122673736 missense probably benign
Enfermo UTSW 5 122652789 missense probably damaging 0.98
Incapacitated UTSW 5 122673793 missense probably damaging 0.99
Sickpuppy UTSW 5 122681003 missense probably damaging 0.96
PIT1430001:P2rx7 UTSW 5 122681216 missense probably damaging 0.99
R0363:P2rx7 UTSW 5 122657030 nonsense probably null
R0558:P2rx7 UTSW 5 122673798 missense possibly damaging 0.83
R1186:P2rx7 UTSW 5 122670451 missense probably damaging 1.00
R1709:P2rx7 UTSW 5 122670465 missense possibly damaging 0.95
R1856:P2rx7 UTSW 5 122681032 missense probably damaging 1.00
R1899:P2rx7 UTSW 5 122673736 missense probably benign
R1905:P2rx7 UTSW 5 122680952 missense probably damaging 1.00
R2082:P2rx7 UTSW 5 122644095 missense possibly damaging 0.92
R2117:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R2205:P2rx7 UTSW 5 122681101 missense probably damaging 1.00
R2446:P2rx7 UTSW 5 122680816 missense probably benign
R3151:P2rx7 UTSW 5 122681266 missense probably benign 0.00
R4052:P2rx7 UTSW 5 122666277 missense probably damaging 1.00
R4883:P2rx7 UTSW 5 122681066 missense probably damaging 1.00
R4930:P2rx7 UTSW 5 122670479 missense probably damaging 1.00
R5194:P2rx7 UTSW 5 122673795 missense probably benign 0.00
R5258:P2rx7 UTSW 5 122681003 missense probably damaging 0.96
R5481:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R5656:P2rx7 UTSW 5 122673717 missense probably damaging 0.99
R5738:P2rx7 UTSW 5 122652789 missense probably damaging 0.98
R6587:P2rx7 UTSW 5 122664550 missense probably damaging 1.00
R7098:P2rx7 UTSW 5 122673793 missense probably damaging 0.99
R7120:P2rx7 UTSW 5 122681294 missense probably benign
R7180:P2rx7 UTSW 5 122680820 missense possibly damaging 0.89
R7358:P2rx7 UTSW 5 122666142 critical splice acceptor site probably null
R7724:P2rx7 UTSW 5 122673373 missense probably benign 0.07
Z1177:P2rx7 UTSW 5 122663641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGGTCTGGAAACTTGAC -3'
(R):5'- GGCATAGCACCTGTAAGCAC -3'

Sequencing Primer
(F):5'- GACTTTTTCAGAGACCCCAGATGG -3'
(R):5'- ATAGCACCTGTAAGCACGGTGTC -3'
Posted On2016-07-06