Incidental Mutation 'R0455:Olfr739'
ID39976
Institutional Source Beutler Lab
Gene Symbol Olfr739
Ensembl Gene ENSMUSG00000057903
Gene Nameolfactory receptor 739
SynonymsMOR106-2, GA_x6K02T2PMLR-6121675-6122604
MMRRC Submission 038655-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0455 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location50418626-50427888 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 50424902 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 128 (I128V)
Ref Sequence ENSEMBL: ENSMUSP00000150559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075261] [ENSMUST00000216949]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075261
AA Change: I128V

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000074740
Gene: ENSMUSG00000057903
AA Change: I128V

DomainStartEndE-ValueType
Pfam:7tm_4 33 309 1.1e-53 PFAM
Pfam:7tm_1 43 292 1.9e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000216949
AA Change: I128V

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik C T 4: 103,230,983 G342D possibly damaging Het
Acvr2b C T 9: 119,432,609 R399W probably damaging Het
AI464131 G A 4: 41,499,538 R31* probably null Het
Atf6 A G 1: 170,834,923 V256A probably benign Het
Atp2b4 A T 1: 133,728,716 I732N probably damaging Het
C1qtnf9 A C 14: 60,772,371 Q25H probably damaging Het
Ccdc6 T A 10: 70,142,571 probably benign Het
Cds2 T C 2: 132,285,967 probably null Het
Chdh A G 14: 30,034,646 Y343C probably damaging Het
Col5a2 T C 1: 45,382,102 probably benign Het
Cts3 G A 13: 61,568,210 probably benign Het
Cyfip1 T A 7: 55,892,054 D362E probably benign Het
Dsg1b T A 18: 20,396,025 S273T probably benign Het
Dysf A T 6: 84,140,667 H1274L probably benign Het
Eva1c T C 16: 90,876,098 S187P probably benign Het
Fam126b T C 1: 58,534,479 probably benign Het
Fam13b G A 18: 34,445,528 probably benign Het
Fam172a T A 13: 77,834,713 probably benign Het
Fbn2 C T 18: 58,035,336 G2310S probably damaging Het
Fcna T C 2: 25,625,508 Y183C probably damaging Het
Fnta T C 8: 26,001,028 T263A probably benign Het
Gm94 T C 18: 43,781,244 D83G possibly damaging Het
Gnal C T 18: 67,135,649 probably benign Het
Grb7 T G 11: 98,452,188 S244A probably benign Het
Grm3 T C 5: 9,512,477 T458A probably benign Het
Hdac2 C T 10: 36,991,836 R193C probably damaging Het
Ighmbp2 T C 19: 3,265,072 R783G probably benign Het
Inpp5j G T 11: 3,503,122 L43I possibly damaging Het
Itga11 A T 9: 62,696,961 T44S probably damaging Het
Itsn1 C T 16: 91,868,148 probably benign Het
Kdm6b G T 11: 69,406,996 C233* probably null Het
Lamb3 T C 1: 193,343,392 L1130P probably damaging Het
Lrch3 T C 16: 32,986,880 F508L probably damaging Het
Lrrd1 T A 5: 3,866,425 V814E probably benign Het
Megf10 C T 18: 57,252,982 P356S probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Nus1 T A 10: 52,430,094 V42E probably damaging Het
Olfr435 A C 6: 43,202,072 M143L probably benign Het
Padi3 T C 4: 140,795,713 N306S probably damaging Het
Pex13 T C 11: 23,655,949 S94G probably benign Het
Ppm1h G T 10: 122,802,324 Q166H probably benign Het
Ptafr A T 4: 132,580,085 Y262F probably benign Het
Rabgap1 T A 2: 37,487,120 D321E probably damaging Het
Samsn1 C T 16: 75,945,225 noncoding transcript Het
Scarb1 T C 5: 125,289,681 N63D probably damaging Het
Serpinb7 T C 1: 107,451,610 I249T possibly damaging Het
Srpr A G 9: 35,214,981 K490R probably benign Het
Sycn A G 7: 28,540,973 N22D probably benign Het
Tarbp1 C T 8: 126,440,873 A1067T probably benign Het
Tex14 A G 11: 87,514,305 D681G possibly damaging Het
Usp34 C T 11: 23,446,741 probably benign Het
Vmn2r107 T C 17: 20,374,823 probably benign Het
Vwde A T 6: 13,187,529 M653K probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Other mutations in Olfr739
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01719:Olfr739 APN 14 50424561 missense possibly damaging 0.88
IGL02430:Olfr739 APN 14 50425151 missense probably benign
IGL02603:Olfr739 APN 14 50425200 missense probably damaging 1.00
IGL02959:Olfr739 APN 14 50424932 missense possibly damaging 0.76
IGL03154:Olfr739 APN 14 50424623 missense probably benign 0.00
R1984:Olfr739 UTSW 14 50425391 missense possibly damaging 0.93
R3160:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3161:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R3162:Olfr739 UTSW 14 50425031 missense probably damaging 0.99
R4821:Olfr739 UTSW 14 50424749 missense possibly damaging 0.96
R4880:Olfr739 UTSW 14 50425301 missense possibly damaging 0.90
R5047:Olfr739 UTSW 14 50425239 missense probably damaging 1.00
R5384:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5385:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5386:Olfr739 UTSW 14 50425389 missense possibly damaging 0.77
R5640:Olfr739 UTSW 14 50424654 missense probably benign 0.18
R5809:Olfr739 UTSW 14 50425448 makesense probably null
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6035:Olfr739 UTSW 14 50424527 missense probably benign
R6229:Olfr739 UTSW 14 50425205 missense probably benign 0.38
R6614:Olfr739 UTSW 14 50425089 missense probably benign 0.00
R7308:Olfr739 UTSW 14 50425265 missense possibly damaging 0.57
R7443:Olfr739 UTSW 14 50425050 missense probably damaging 1.00
R7699:Olfr739 UTSW 14 50425335 missense probably benign
R7700:Olfr739 UTSW 14 50425335 missense probably benign
R7851:Olfr739 UTSW 14 50425370 missense probably damaging 0.99
R8397:Olfr739 UTSW 14 50424680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGATCAGAAACTTCACACCCC -3'
(R):5'- TGCATTCCAGCTTCATGCTCAGATG -3'

Sequencing Primer
(F):5'- AACTTCTCCTTCCTGGAAATCTG -3'
(R):5'- CTACTGTGAGATGAGATCCGC -3'
Posted On2013-05-23