Incidental Mutation 'R5180:Daam1'
ID399760
Institutional Source Beutler Lab
Gene Symbol Daam1
Ensembl Gene ENSMUSG00000034574
Gene Namedishevelled associated activator of morphogenesis 1
Synonyms1700066F09Rik, 2310028E21Rik
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location71831078-71992333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71947125 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 434 (N434S)
Ref Sequence ENSEMBL: ENSMUSP00000152564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085299] [ENSMUST00000221317] [ENSMUST00000223272]
Predicted Effect unknown
Transcript: ENSMUST00000085299
AA Change: N434S
SMART Domains Protein: ENSMUSP00000082406
Gene: ENSMUSG00000034574
AA Change: N434S

DomainStartEndE-ValueType
Drf_GBD 45 232 4.99e-67 SMART
Drf_FH3 235 433 1.92e-77 SMART
SCOP:d1eq1a_ 442 522 4e-3 SMART
Blast:Drf_FH3 459 519 1e-9 BLAST
SCOP:d1jvr__ 532 565 5e-3 SMART
FH2 600 1060 9.99e-110 SMART
Predicted Effect unknown
Transcript: ENSMUST00000221317
AA Change: N434S
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222327
Predicted Effect unknown
Transcript: ENSMUST00000223272
AA Change: N434S
Meta Mutation Damage Score 0.2211 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cell motility, adhesion, cytokinesis, and other functions of the cell cortex are mediated by reorganization of the actin cytoskeleton and several formin homology (FH) proteins have been associated with these processes. The protein encoded by this gene contains two FH domains and belongs to a novel FH protein subfamily implicated in cell polarity. A key regulator of cytoskeletal architecture, the small GTPase Rho, is activated during development by Wnt/Fz signaling to control cell polarity and movement. The protein encoded by this gene is thought to function as a scaffolding protein for the Wnt-induced assembly of a disheveled (Dvl)-Rho complex. This protein also promotes the nucleation and elongation of new actin filaments and regulates cell growth through the stabilization of microtubules. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a gene trap allele show reduced fetal size, partial embryonic and neonatal lethality, altered cytoskeletal structure, cardiac defects including ventricular noncompaction, double outlet right ventricles and ventricular septal defects, and impaired cell adhesion and wound healing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Daam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Daam1 APN 12 71942219 missense unknown
IGL00323:Daam1 APN 12 71958743 splice site probably benign
IGL00885:Daam1 APN 12 71944091 missense unknown
IGL01768:Daam1 APN 12 71989885 missense probably benign 0.39
IGL02189:Daam1 APN 12 71946285 missense unknown
IGL02237:Daam1 APN 12 71982721 missense probably benign 0.01
IGL02486:Daam1 APN 12 71947145 splice site probably benign
IGL02561:Daam1 APN 12 71946516 missense unknown
IGL02699:Daam1 APN 12 71988943 missense probably damaging 1.00
IGL02977:Daam1 APN 12 71944172 missense unknown
R0390:Daam1 UTSW 12 71975304 splice site probably benign
R0492:Daam1 UTSW 12 71944380 missense unknown
R0780:Daam1 UTSW 12 71947050 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0973:Daam1 UTSW 12 71915784 missense unknown
R0974:Daam1 UTSW 12 71915784 missense unknown
R1264:Daam1 UTSW 12 71975311 splice site probably benign
R1462:Daam1 UTSW 12 71944142 missense unknown
R1462:Daam1 UTSW 12 71944142 missense unknown
R1510:Daam1 UTSW 12 71977726 missense probably damaging 1.00
R1535:Daam1 UTSW 12 71951918 missense unknown
R1688:Daam1 UTSW 12 71947046 missense unknown
R1713:Daam1 UTSW 12 71895882 missense unknown
R1957:Daam1 UTSW 12 71982755 critical splice donor site probably null
R1974:Daam1 UTSW 12 71988929 missense probably damaging 0.99
R2217:Daam1 UTSW 12 71989827 missense probably damaging 1.00
R2507:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R2508:Daam1 UTSW 12 71975223 missense probably damaging 1.00
R3161:Daam1 UTSW 12 71947098 missense unknown
R3748:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R3749:Daam1 UTSW 12 71971166 missense probably damaging 1.00
R4635:Daam1 UTSW 12 71958744 splice site probably null
R4862:Daam1 UTSW 12 71942207 missense unknown
R5033:Daam1 UTSW 12 71946520 missense unknown
R5202:Daam1 UTSW 12 71944274 missense unknown
R5254:Daam1 UTSW 12 71946576 missense unknown
R5358:Daam1 UTSW 12 71952459 nonsense probably null
R5413:Daam1 UTSW 12 71946292 missense unknown
R5733:Daam1 UTSW 12 71945498 missense unknown
R5752:Daam1 UTSW 12 71946546 missense unknown
R5891:Daam1 UTSW 12 71944149 missense unknown
R6111:Daam1 UTSW 12 71942264 missense unknown
R6182:Daam1 UTSW 12 71959887 nonsense probably null
R6251:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6252:Daam1 UTSW 12 71988949 missense probably damaging 1.00
R6291:Daam1 UTSW 12 71946251 missense unknown
R6379:Daam1 UTSW 12 71951938 missense unknown
R6776:Daam1 UTSW 12 71989808 missense possibly damaging 0.96
R7167:Daam1 UTSW 12 71988904 missense probably damaging 0.99
R7223:Daam1 UTSW 12 71988943 missense probably damaging 1.00
R7340:Daam1 UTSW 12 71988939 missense probably benign 0.28
R7467:Daam1 UTSW 12 71985806 nonsense probably null
R7709:Daam1 UTSW 12 71977649 missense probably benign 0.10
R7715:Daam1 UTSW 12 71988901 missense probably benign 0.15
R8157:Daam1 UTSW 12 71952489 missense probably damaging 1.00
R8187:Daam1 UTSW 12 71895828 missense unknown
R8297:Daam1 UTSW 12 71951915 missense unknown
X0019:Daam1 UTSW 12 71985692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACAGCGACTCATCCTAGTTTAC -3'
(R):5'- GTCTCTCTGGGCACACAAAC -3'

Sequencing Primer
(F):5'- CTAGTTTACACACAGCCTGAAGATGG -3'
(R):5'- CAGTGTACTGCAGAGTCCTTG -3'
Posted On2016-07-06