Incidental Mutation 'R5180:Tbc1d4'
ID399770
Institutional Source Beutler Lab
Gene Symbol Tbc1d4
Ensembl Gene ENSMUSG00000033083
Gene NameTBC1 domain family, member 4
Synonyms5930406J04Rik, AS160
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location101442360-101609191 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101507572 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 206 (Y206C)
Ref Sequence ENSEMBL: ENSMUSP00000124909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100340] [ENSMUST00000161991] [ENSMUST00000162617]
Predicted Effect probably damaging
Transcript: ENSMUST00000100340
AA Change: Y206C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097913
Gene: ENSMUSG00000033083
AA Change: Y206C

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Blast:TBC 773 834 3e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159668
Predicted Effect probably benign
Transcript: ENSMUST00000159951
SMART Domains Protein: ENSMUSP00000124511
Gene: ENSMUSG00000033083

DomainStartEndE-ValueType
PTB 28 170 8.6e-22 SMART
Pfam:DUF3350 459 522 2.3e-31 PFAM
TBC 574 794 5.2e-77 SMART
Blast:TBC 819 877 7e-24 BLAST
Blast:TBC 882 936 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160473
Predicted Effect probably damaging
Transcript: ENSMUST00000161991
AA Change: Y206C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125509
Gene: ENSMUSG00000033083
AA Change: Y206C

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
Pfam:DUF3350 746 809 1.2e-27 PFAM
TBC 860 1080 5.2e-77 SMART
Blast:TBC 1105 1163 1e-23 BLAST
Blast:TBC 1168 1222 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162617
AA Change: Y206C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124909
Gene: ENSMUSG00000033083
AA Change: Y206C

DomainStartEndE-ValueType
PTB 31 191 2.08e-29 SMART
PTB 197 457 3.16e-29 SMART
low complexity region 708 720 N/A INTRINSIC
Pfam:DUF3350 809 872 3.3e-31 PFAM
TBC 923 1143 5.2e-77 SMART
Blast:TBC 1168 1226 2e-23 BLAST
Blast:TBC 1231 1285 1e-20 BLAST
Meta Mutation Damage Score 0.7917 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Tre-2/BUB2/CDC16 domain family. The protein encoded by this gene is a Rab-GTPase-activating protein, and contains two phopshotyrosine-binding domains (PTB1 and PTB2), a calmodulin-binding domain (CBD), a Rab-GTPase domain, and multiple AKT phosphomotifs. This protein is thought to play an important role in glucose homeostasis by regulating the insulin-dependent trafficking of the glucose transporter 4 (GLUT4), important for removing glucose from the bloodstream into skeletal muscle and fat tissues. Reduced expression of this gene results in an increase in GLUT4 levels at the plasma membrane, suggesting that this protein is important in intracellular retention of GLUT4 under basal conditions. When exposed to insulin, this protein is phosphorylated, dissociates from GLUT4 vesicles, resulting in increased GLUT4 at the cell surface, and enhanced glucose transport. Phosphorylation of this protein by AKT is required for proper translocation of GLUT4 to the cell surface. Individuals homozygous for a mutation in this gene are at higher risk for type 2 diabetes and have higher levels of circulating glucose and insulin levels after glucose ingestion. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit reduced blood glucose levels under both fasted and fed conditions, insulin resistance in both muscle and liver, decreased energy expenditure and oxygen consumption, abnormal adipocyte and muscle cell glucose uptake, and increased hepatic gluconeogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Tbc1d4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Tbc1d4 APN 14 101608112 missense probably damaging 1.00
IGL00864:Tbc1d4 APN 14 101444566 missense probably benign 0.23
IGL01065:Tbc1d4 APN 14 101449193 splice site probably benign
IGL01144:Tbc1d4 APN 14 101444663 missense probably damaging 0.99
IGL01153:Tbc1d4 APN 14 101608015 missense possibly damaging 0.52
IGL01472:Tbc1d4 APN 14 101489864 nonsense probably null
IGL02177:Tbc1d4 APN 14 101454939 missense possibly damaging 0.90
IGL02259:Tbc1d4 APN 14 101465730 missense probably damaging 1.00
IGL02938:Tbc1d4 APN 14 101501100 missense probably damaging 1.00
IGL02975:Tbc1d4 APN 14 101458113 missense probably damaging 1.00
R0396:Tbc1d4 UTSW 14 101458063 splice site probably null
R0787:Tbc1d4 UTSW 14 101449209 missense probably damaging 1.00
R0944:Tbc1d4 UTSW 14 101479220 splice site probably benign
R1167:Tbc1d4 UTSW 14 101608019 missense probably damaging 1.00
R1456:Tbc1d4 UTSW 14 101507106 missense probably damaging 1.00
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1465:Tbc1d4 UTSW 14 101447688 missense possibly damaging 0.87
R1672:Tbc1d4 UTSW 14 101475215 missense possibly damaging 0.92
R1762:Tbc1d4 UTSW 14 101507138 missense possibly damaging 0.95
R2057:Tbc1d4 UTSW 14 101477155 missense probably damaging 0.97
R2260:Tbc1d4 UTSW 14 101494411 missense probably damaging 1.00
R2762:Tbc1d4 UTSW 14 101494361 missense probably damaging 1.00
R3814:Tbc1d4 UTSW 14 101458755 missense possibly damaging 0.94
R3983:Tbc1d4 UTSW 14 101507213 missense probably benign 0.00
R4498:Tbc1d4 UTSW 14 101608336 missense probably damaging 1.00
R4580:Tbc1d4 UTSW 14 101458783 missense probably benign 0.00
R4664:Tbc1d4 UTSW 14 101462827 intron probably benign
R4872:Tbc1d4 UTSW 14 101444708 missense probably benign 0.06
R4940:Tbc1d4 UTSW 14 101507231 missense probably benign 0.27
R4964:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R4966:Tbc1d4 UTSW 14 101458174 missense probably damaging 1.00
R5103:Tbc1d4 UTSW 14 101458882 nonsense probably null
R5366:Tbc1d4 UTSW 14 101607976 missense possibly damaging 0.67
R5673:Tbc1d4 UTSW 14 101455008 missense probably damaging 1.00
R6057:Tbc1d4 UTSW 14 101489917 missense probably damaging 0.99
R6180:Tbc1d4 UTSW 14 101458770 missense probably benign 0.01
R6361:Tbc1d4 UTSW 14 101507174 missense probably damaging 0.97
R6509:Tbc1d4 UTSW 14 101608318 missense possibly damaging 0.92
R6791:Tbc1d4 UTSW 14 101608259 missense probably damaging 0.98
R7001:Tbc1d4 UTSW 14 101458749 missense probably benign 0.43
R7016:Tbc1d4 UTSW 14 101487441 missense probably damaging 1.00
R7575:Tbc1d4 UTSW 14 101447589 missense probably damaging 1.00
R7691:Tbc1d4 UTSW 14 101507641 missense probably damaging 1.00
R7936:Tbc1d4 UTSW 14 101465754 missense probably damaging 1.00
R7991:Tbc1d4 UTSW 14 101608279 missense probably damaging 0.98
R8182:Tbc1d4 UTSW 14 101507554 missense probably damaging 1.00
Z1088:Tbc1d4 UTSW 14 101452423 missense probably damaging 1.00
Z1176:Tbc1d4 UTSW 14 101507087 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCATCTGGAGACACAGGAGAC -3'
(R):5'- TGTAGGCGCTGCACTACTTG -3'

Sequencing Primer
(F):5'- GGAGACTCGACCTCAAGGAC -3'
(R):5'- GTTCAGGTGACCAGAAATGATCTTAG -3'
Posted On2016-07-06