Incidental Mutation 'R5180:Zhx1'
ID399774
Institutional Source Beutler Lab
Gene Symbol Zhx1
Ensembl Gene ENSMUSG00000022361
Gene Namezinc fingers and homeoboxes 1
Synonyms
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location58047003-58076541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 58054074 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 259 (G259R)
Ref Sequence ENSEMBL: ENSMUSP00000135230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070143] [ENSMUST00000110168] [ENSMUST00000175805] [ENSMUST00000176076] [ENSMUST00000176935] [ENSMUST00000177176] [ENSMUST00000177276] [ENSMUST00000177504]
Predicted Effect probably damaging
Transcript: ENSMUST00000070143
AA Change: G259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066201
Gene: ENSMUSG00000022361
AA Change: G259R

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110168
AA Change: G259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105797
Gene: ENSMUSG00000022361
AA Change: G259R

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175805
AA Change: G259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134844
Gene: ENSMUSG00000022361
AA Change: G259R

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176270
Predicted Effect probably benign
Transcript: ENSMUST00000176935
SMART Domains Protein: ENSMUSP00000134752
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177176
Predicted Effect probably damaging
Transcript: ENSMUST00000177276
AA Change: G259R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135230
Gene: ENSMUSG00000022361
AA Change: G259R

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 623 2.77e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177504
SMART Domains Protein: ENSMUSP00000135111
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Meta Mutation Damage Score 0.1460 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 1 of this gene family. In addition to forming homodimers, this protein heterodimerizes with members 2 and 3 of the zinc fingers and homeoboxes family. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 8 open reading frame 76 (C8orf76) gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Zhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Zhx1 APN 15 58053315 missense probably damaging 1.00
IGL00819:Zhx1 APN 15 58054694 missense probably benign 0.00
IGL01025:Zhx1 APN 15 58054679 missense probably benign 0.32
IGL01867:Zhx1 APN 15 58054445 missense probably damaging 1.00
IGL02000:Zhx1 APN 15 58054287 missense probably damaging 1.00
IGL02093:Zhx1 APN 15 58052868 missense probably benign
IGL02156:Zhx1 APN 15 58054049 missense possibly damaging 0.89
IGL02399:Zhx1 APN 15 58053741 missense probably damaging 1.00
IGL02479:Zhx1 APN 15 58054371 missense probably damaging 1.00
R0667:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
R1502:Zhx1 UTSW 15 58054596 missense probably damaging 1.00
R2923:Zhx1 UTSW 15 58053681 missense probably damaging 0.99
R3039:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R3401:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3403:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3979:Zhx1 UTSW 15 58053240 missense probably benign 0.14
R4086:Zhx1 UTSW 15 58052921 missense possibly damaging 0.93
R5013:Zhx1 UTSW 15 58054142 missense possibly damaging 0.61
R5124:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5125:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5181:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5186:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5187:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5408:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5490:Zhx1 UTSW 15 58053299 missense probably damaging 1.00
R5629:Zhx1 UTSW 15 58054811 missense probably damaging 1.00
R6314:Zhx1 UTSW 15 58054002 missense probably benign 0.01
R6768:Zhx1 UTSW 15 58054103 missense probably benign 0.27
R7081:Zhx1 UTSW 15 58054338 missense probably benign 0.00
R7211:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R7219:Zhx1 UTSW 15 58054337 missense probably benign
R7232:Zhx1 UTSW 15 58053069 missense probably benign 0.04
R7275:Zhx1 UTSW 15 58054362 missense probably benign
R7287:Zhx1 UTSW 15 58053296 missense probably damaging 1.00
R7369:Zhx1 UTSW 15 58053300 missense probably damaging 1.00
R7381:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
R7810:Zhx1 UTSW 15 58048402 splice site probably null
R8103:Zhx1 UTSW 15 58053266 missense probably benign 0.32
R8256:Zhx1 UTSW 15 58052963 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- ACGTTGGGCTGAAAACCAGATC -3'
(R):5'- CTGAGGGCACTTCTGAAGAG -3'

Sequencing Primer
(F):5'- GGGCTGAAAACCAGATCTTGATTTG -3'
(R):5'- CTGAGGGCACTTCTGAAGAGAAAGAG -3'
Posted On2016-07-06