Incidental Mutation 'R5257:Foxi2'
ID399777
Institutional Source Beutler Lab
Gene Symbol Foxi2
Ensembl Gene ENSMUSG00000048377
Gene Nameforkhead box I2
SynonymsB130055A05Rik
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5257 (G1)
Quality Score136
Status Validated
Chromosome7
Chromosomal Location135410308-135413622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135410527 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 48 (T48M)
Ref Sequence ENSEMBL: ENSMUSP00000053641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060356]
Predicted Effect probably benign
Transcript: ENSMUST00000060356
AA Change: T48M

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000053641
Gene: ENSMUSG00000048377
AA Change: T48M

DomainStartEndE-ValueType
low complexity region 64 82 N/A INTRINSIC
low complexity region 87 108 N/A INTRINSIC
FH 115 205 1.29e-58 SMART
low complexity region 207 213 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
low complexity region 262 278 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele are viable and fertile with no gross abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Foxi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01101:Foxi2 APN 7 135412007 missense probably benign 0.07
IGL02984:Foxi2 UTSW 7 135410398 missense possibly damaging 0.96
R0030:Foxi2 UTSW 7 135411616 missense probably damaging 0.99
R0030:Foxi2 UTSW 7 135411616 missense probably damaging 0.99
R0121:Foxi2 UTSW 7 135411911 missense probably benign
R0830:Foxi2 UTSW 7 135411730 missense probably benign
R2059:Foxi2 UTSW 7 135410677 missense probably damaging 1.00
R3615:Foxi2 UTSW 7 135410451 missense possibly damaging 0.88
R3616:Foxi2 UTSW 7 135410451 missense possibly damaging 0.88
R4021:Foxi2 UTSW 7 135410530 missense probably damaging 1.00
R4764:Foxi2 UTSW 7 135410667 missense probably damaging 1.00
R5048:Foxi2 UTSW 7 135411635 missense probably damaging 1.00
R5258:Foxi2 UTSW 7 135410527 missense probably benign 0.19
R5561:Foxi2 UTSW 7 135411647 missense probably damaging 1.00
R5611:Foxi2 UTSW 7 135411704 missense probably benign 0.00
R5667:Foxi2 UTSW 7 135410939 splice site probably null
R7492:Foxi2 UTSW 7 135410572 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTTAAAGGGCCCAGGTCAG -3'
(R):5'- CGATCAGTGCTGAGTAGGAG -3'

Sequencing Primer
(F):5'- CCCAGGTCAGGAGTGTGAG -3'
(R):5'- GTACCAGCCTCAGCAGCTC -3'
Posted On2016-07-06