Incidental Mutation 'R5257:Tfdp1'
ID399783
Institutional Source Beutler Lab
Gene Symbol Tfdp1
Ensembl Gene ENSMUSG00000038482
Gene Nametranscription factor Dp 1
SynonymsDrtf1, Dp1
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location13338751-13378448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13369529 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 86 (T86M)
Ref Sequence ENSEMBL: ENSMUSP00000147536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170909] [ENSMUST00000209282] [ENSMUST00000209396] [ENSMUST00000209885] [ENSMUST00000209945] [ENSMUST00000210165] [ENSMUST00000210501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000170909
AA Change: T86M

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127952
Gene: ENSMUSG00000038482
AA Change: T86M

DomainStartEndE-ValueType
E2F_TDP 111 193 1.51e-34 SMART
DP 200 344 4.07e-90 SMART
low complexity region 395 410 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000209282
AA Change: T86M

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209396
Predicted Effect possibly damaging
Transcript: ENSMUST00000209885
AA Change: T86M

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000209945
AA Change: T22M

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210165
AA Change: T28M

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000210501
AA Change: T86M

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211606
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transcription factors that heterodimerize with E2F proteins to enhance their DNA-binding activity and promote transcription from E2F target genes. The encoded protein functions as part of this complex to control the transcriptional activity of numerous genes involved in cell cycle progression from G1 to S phase. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1, 15, and X.[provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced expansion of the ectoplacental cone and chorion, small yolk sacs, and impaired endoreduplication in trophoblast giant cells. Mutants die by embryonic day 12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Acpp T C 9: 104,309,475 I266V probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Tfdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Tfdp1 APN 8 13369546 missense possibly damaging 0.95
gangly UTSW 8 13357038 splice site probably null
PIT1430001:Tfdp1 UTSW 8 13372526 missense probably benign 0.35
R1139:Tfdp1 UTSW 8 13373000 missense probably benign 0.14
R1264:Tfdp1 UTSW 8 13373837 splice site probably benign
R1485:Tfdp1 UTSW 8 13370917 missense probably damaging 0.99
R1967:Tfdp1 UTSW 8 13373039 missense possibly damaging 0.59
R4849:Tfdp1 UTSW 8 13373895 missense probably benign
R4965:Tfdp1 UTSW 8 13373073 missense probably damaging 0.99
R5258:Tfdp1 UTSW 8 13369529 missense possibly damaging 0.92
R5895:Tfdp1 UTSW 8 13357038 splice site probably null
R6785:Tfdp1 UTSW 8 13370485 missense probably damaging 0.99
R6785:Tfdp1 UTSW 8 13377233 missense possibly damaging 0.85
R6786:Tfdp1 UTSW 8 13370485 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATGTACGGGTGTCTGAGC -3'
(R):5'- CACTTTCTAAGCGTTTGTGTCG -3'

Sequencing Primer
(F):5'- TGCCACAGCAGAGCAGC -3'
(R):5'- TTCTCTGTGGCCCAGTCAGAG -3'
Posted On2016-07-06