Incidental Mutation 'R5180:Cyp4f15'
ID399788
Institutional Source Beutler Lab
Gene Symbol Cyp4f15
Ensembl Gene ENSMUSG00000073424
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 15
Synonyms
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.691) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location32685627-32703352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32690740 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 104 (I104F)
Ref Sequence ENSEMBL: ENSMUSP00000129264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008801] [ENSMUST00000168171]
Predicted Effect probably benign
Transcript: ENSMUST00000008801
AA Change: I104F

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000008801
Gene: ENSMUSG00000073424
AA Change: I104F

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
Pfam:p450 57 520 8.4e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167789
Predicted Effect probably benign
Transcript: ENSMUST00000168171
AA Change: I104F

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129264
Gene: ENSMUSG00000073424
AA Change: I104F

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
Pfam:p450 57 527 3.2e-133 PFAM
Meta Mutation Damage Score 0.1403 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, CYP4F8, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and functions as a 19-hydroxylase of prostaglandins in seminal vesicles. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Another member of this family, CYP4F3, is approximately 18 kb away. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Cyp4f15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Cyp4f15 APN 17 32686157 missense probably benign 0.01
IGL01813:Cyp4f15 APN 17 32686157 missense probably benign 0.01
IGL02394:Cyp4f15 APN 17 32692635 missense possibly damaging 0.76
IGL02547:Cyp4f15 APN 17 32700255 missense probably benign 0.03
IGL02743:Cyp4f15 APN 17 32699952 missense possibly damaging 0.56
IGL03120:Cyp4f15 APN 17 32690764 missense probably damaging 0.97
IGL03124:Cyp4f15 APN 17 32685812 critical splice donor site probably null
IGL03342:Cyp4f15 APN 17 32697936 missense probably damaging 1.00
PIT4472001:Cyp4f15 UTSW 17 32702824 missense probably damaging 0.99
R2016:Cyp4f15 UTSW 17 32702159 missense probably damaging 1.00
R2892:Cyp4f15 UTSW 17 32686208 missense probably benign
R3812:Cyp4f15 UTSW 17 32686177 missense probably benign
R4803:Cyp4f15 UTSW 17 32692580 missense probably benign 0.00
R5199:Cyp4f15 UTSW 17 32702372 missense probably benign
R5787:Cyp4f15 UTSW 17 32702808 missense probably damaging 1.00
R6695:Cyp4f15 UTSW 17 32692612 nonsense probably null
R8311:Cyp4f15 UTSW 17 32697940 missense probably benign 0.06
R8342:Cyp4f15 UTSW 17 32690759 missense possibly damaging 0.94
R8369:Cyp4f15 UTSW 17 32697965 missense probably benign 0.03
R8503:Cyp4f15 UTSW 17 32695364 missense probably damaging 0.99
Z1088:Cyp4f15 UTSW 17 32692690 splice site probably null
Predicted Primers PCR Primer
(F):5'- GGGTCGCAATATTAAGAAGATTGAC -3'
(R):5'- AAGCCCTGAAGATTCTACCATG -3'

Sequencing Primer
(F):5'- GTCATTCTGACCGAGACTACTGATG -3'
(R):5'- CCTGAAGATTCTACCATGCTCTG -3'
Posted On2016-07-06