Incidental Mutation 'R5257:Acpp'
ID399789
Institutional Source Beutler Lab
Gene Symbol Acpp
Ensembl Gene ENSMUSG00000032561
Gene Nameacid phosphatase, prostate
SynonymsA030005E02Rik, PAP
MMRRC Submission 042855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R5257 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104288251-104337748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104309475 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 266 (I266V)
Ref Sequence ENSEMBL: ENSMUSP00000108209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062723] [ENSMUST00000112590]
Predicted Effect probably benign
Transcript: ENSMUST00000062723
AA Change: I266V

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059889
Gene: ENSMUSG00000032561
AA Change: I266V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 3.8e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112590
AA Change: I266V

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108209
Gene: ENSMUSG00000032561
AA Change: I266V

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 1.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194330
Meta Mutation Damage Score 0.2456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thermal nociceptive threshold and mechanical allodynia in chronic inflammatory and nerve injury pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,249,684 T128S possibly damaging Het
Abca16 T G 7: 120,436,769 probably null Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Asf1b C T 8: 83,969,267 T179I probably benign Het
Astn1 A G 1: 158,612,532 K890R probably damaging Het
Card11 G A 5: 140,876,425 P1039L possibly damaging Het
Chsy3 A G 18: 59,409,794 E668G possibly damaging Het
Cnot8 T A 11: 58,117,522 N271K possibly damaging Het
Dcaf5 G T 12: 80,397,719 P200H probably damaging Het
Dkk4 C A 8: 22,627,015 L215I probably damaging Het
Dnhd1 C T 7: 105,674,037 T584I probably benign Het
Dock3 T C 9: 106,996,925 Y449C probably damaging Het
Dsg1a A G 18: 20,320,931 D31G probably damaging Het
Fgfr1op T C 17: 8,172,943 S152P probably benign Het
Foxi2 C T 7: 135,410,527 T48M probably benign Het
Gdf3 T C 6: 122,606,386 M341V probably damaging Het
Gm21738 A G 14: 19,415,942 L199S probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Igkv4-80 T A 6: 69,016,827 T27S probably benign Het
Ipo9 A T 1: 135,385,435 C1019S probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Ktn1 T A 14: 47,667,363 H199Q probably benign Het
Kyat3 A G 3: 142,734,576 M354V probably benign Het
Lbhd1 A G 19: 8,884,089 probably benign Het
Llgl1 G C 11: 60,711,563 probably null Het
Lyzl6 T A 11: 103,635,073 I74F probably damaging Het
Mfsd4b2 T A 10: 39,922,021 M113L probably benign Het
Mslnl T C 17: 25,746,165 Y502H probably benign Het
Nckap5 A G 1: 126,024,508 S1372P probably damaging Het
Nle1 T C 11: 82,904,946 D225G probably damaging Het
Olfr221 T C 14: 52,035,884 T76A possibly damaging Het
P2rx7 A G 5: 122,681,003 E496G probably damaging Het
Padi4 C T 4: 140,746,204 V641M probably benign Het
Phf11d T C 14: 59,352,711 I221V possibly damaging Het
Pla2g2c G A 4: 138,731,545 probably benign Het
Prdm16 A T 4: 154,367,214 D179E possibly damaging Het
Psca A T 15: 74,716,391 I56F probably damaging Het
Ptrhd1 A G 12: 4,236,481 Y124C probably damaging Het
Sardh T C 2: 27,244,259 T82A probably damaging Het
Sesn1 C T 10: 41,894,988 P172S probably benign Het
Setd4 T C 16: 93,596,333 T57A probably damaging Het
Skint5 T C 4: 113,577,662 T1037A unknown Het
Slc18a3 T C 14: 32,463,820 D202G probably damaging Het
Slc44a5 G A 3: 154,243,123 C176Y probably damaging Het
Slc6a5 G A 7: 49,929,992 V373M probably damaging Het
Sorbs3 T C 14: 70,185,034 I523V probably benign Het
Sspo T C 6: 48,476,494 V2872A probably damaging Het
Stard9 T A 2: 120,699,343 L2027H probably damaging Het
Tex2 T A 11: 106,567,759 probably benign Het
Tfdp1 C T 8: 13,369,529 T86M possibly damaging Het
Ttc6 A T 12: 57,702,275 D1331V possibly damaging Het
Vps13b A G 15: 35,794,421 T2326A possibly damaging Het
Wnk1 A G 6: 120,037,188 S149P probably benign Het
Zfp521 G A 18: 13,846,978 S126F probably damaging Het
Zfp958 A T 8: 4,628,456 E160D probably benign Het
Other mutations in Acpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Acpp APN 9 104326948 missense probably damaging 1.00
IGL02994:Acpp APN 9 104309403 splice site probably benign
IGL03069:Acpp APN 9 104320005 missense possibly damaging 0.78
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0084:Acpp UTSW 9 104314365 missense probably benign 0.07
R0098:Acpp UTSW 9 104319945 unclassified probably null
R0119:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0299:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0362:Acpp UTSW 9 104314427 missense probably damaging 1.00
R0499:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0514:Acpp UTSW 9 104319978 missense probably damaging 1.00
R0964:Acpp UTSW 9 104326975 missense possibly damaging 0.94
R1506:Acpp UTSW 9 104324174 missense probably damaging 1.00
R1624:Acpp UTSW 9 104320001 missense probably benign 0.39
R2019:Acpp UTSW 9 104324702 missense probably damaging 1.00
R3821:Acpp UTSW 9 104324717 missense probably damaging 0.99
R3822:Acpp UTSW 9 104324717 missense probably damaging 0.99
R4896:Acpp UTSW 9 104306975 missense probably damaging 1.00
R5084:Acpp UTSW 9 104326917 missense probably damaging 1.00
R5258:Acpp UTSW 9 104309475 missense probably benign 0.24
R5519:Acpp UTSW 9 104291488 missense probably damaging 1.00
R5795:Acpp UTSW 9 104309489 missense probably benign 0.04
R6909:Acpp UTSW 9 104300965 missense probably damaging 1.00
R7315:Acpp UTSW 9 104316224 critical splice donor site probably null
R7349:Acpp UTSW 9 104291458 missense probably benign 0.01
R7792:Acpp UTSW 9 104326966 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTGACTATCTTGTCATCGG -3'
(R):5'- ATCACACAGCTTGGCATGC -3'

Sequencing Primer
(F):5'- TTACAGTGTAACTTCCACCAGGG -3'
(R):5'- CATGCAGCAGATTATGAGCC -3'
Posted On2016-07-06