Incidental Mutation 'R5180:Slc35a4'
ID399792
Institutional Source Beutler Lab
Gene Symbol Slc35a4
Ensembl Gene ENSMUSG00000033272
Gene Namesolute carrier family 35, member A4
Synonyms
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36679215-36683861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36682635 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 173 (S173P)
Ref Sequence ENSEMBL: ENSMUSP00000140615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001415] [ENSMUST00000036158] [ENSMUST00000050476] [ENSMUST00000115682] [ENSMUST00000185899] [ENSMUST00000186538]
Predicted Effect probably benign
Transcript: ENSMUST00000001415
SMART Domains Protein: ENSMUSP00000001415
Gene: ENSMUSG00000006050

DomainStartEndE-ValueType
WW 30 61 1.72e-7 SMART
low complexity region 85 100 N/A INTRINSIC
PTB 114 260 7.64e-37 SMART
PTB 286 420 4.07e-32 SMART
low complexity region 444 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036158
AA Change: S173P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000036081
Gene: ENSMUSG00000033272
AA Change: S173P

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 36 321 6.7e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050476
AA Change: S173P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129718
Gene: ENSMUSG00000033272
AA Change: S173P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115682
SMART Domains Protein: ENSMUSP00000111346
Gene: ENSMUSG00000044719

DomainStartEndE-ValueType
Blast:KISc 1 105 2e-10 BLAST
SCOP:d1bg2__ 1 105 3e-9 SMART
low complexity region 120 130 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
coiled coil region 354 385 N/A INTRINSIC
coiled coil region 433 460 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170288
Predicted Effect probably benign
Transcript: ENSMUST00000185899
SMART Domains Protein: ENSMUSP00000140201
Gene: ENSMUSG00000033272

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Pfam:DUF4535 63 101 3.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186538
AA Change: S173P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140615
Gene: ENSMUSG00000033272
AA Change: S173P

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
Pfam:Nuc_sug_transp 78 313 2.8e-38 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Olfr1453 A T 19: 13,027,412 S306T probably benign Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Slc35a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02656:Slc35a4 APN 18 36682447 missense probably damaging 0.99
R0980:Slc35a4 UTSW 18 36682781 missense probably damaging 1.00
R1586:Slc35a4 UTSW 18 36683005 missense probably benign
R1723:Slc35a4 UTSW 18 36682735 missense possibly damaging 0.61
R3827:Slc35a4 UTSW 18 36682988 missense probably damaging 0.99
R5732:Slc35a4 UTSW 18 36682341 missense probably benign 0.05
R7101:Slc35a4 UTSW 18 36681538 missense probably damaging 0.99
R7257:Slc35a4 UTSW 18 36679616 missense unknown
R7402:Slc35a4 UTSW 18 36680517 missense unknown
R7606:Slc35a4 UTSW 18 36682585 missense probably benign 0.01
R8299:Slc35a4 UTSW 18 36682927 missense possibly damaging 0.89
Z1088:Slc35a4 UTSW 18 36683093 makesense probably null
Z1176:Slc35a4 UTSW 18 36682763 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTGATTTATCTGCAGCGC -3'
(R):5'- AGTCCAAAGTTCAGGATCACC -3'

Sequencing Primer
(F):5'- GATTTATCTGCAGCGCTACATGGAC -3'
(R):5'- GTTCAGGATCACCCCAAAAGTGTAG -3'
Posted On2016-07-06