Incidental Mutation 'R5180:Olfr1453'
ID399794
Institutional Source Beutler Lab
Gene Symbol Olfr1453
Ensembl Gene ENSMUSG00000094755
Gene Nameolfactory receptor 1453
SynonymsMOR202-6, GA_x6K02T2RE5P-3357666-3356743
MMRRC Submission 042760-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5180 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13027404-13028327 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13027412 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 306 (S306T)
Ref Sequence ENSEMBL: ENSMUSP00000085071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087773]
Predicted Effect probably benign
Transcript: ENSMUST00000087773
AA Change: S306T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000085071
Gene: ENSMUSG00000094755
AA Change: S306T

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.6e-50 PFAM
Pfam:7tm_1 39 288 2.6e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (60/62)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,466,510 T4091A probably benign Het
Adgrv1 G A 13: 81,283,416 probably benign Het
Ago3 C T 4: 126,367,751 V435I probably benign Het
Akap10 C T 11: 61,916,189 A72T probably damaging Het
Ampd2 G T 3: 108,079,042 Q273K probably benign Het
Ankrd35 C A 3: 96,680,473 H109Q probably damaging Het
Atpaf2 A G 11: 60,405,869 L153S possibly damaging Het
C1qtnf7 G A 5: 43,615,814 V152M probably benign Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cep295 C T 9: 15,332,120 C1680Y probably benign Het
Cyp4f15 A T 17: 32,690,740 I104F probably benign Het
Daam1 A G 12: 71,947,125 N434S unknown Het
Dab2ip C T 2: 35,720,491 P782L possibly damaging Het
Dhx34 C A 7: 16,205,480 G663* probably null Het
Dnah7a T C 1: 53,423,287 D3715G probably damaging Het
Dnajc11 C T 4: 151,969,939 R201C probably damaging Het
Erf A T 7: 25,246,265 I27N probably damaging Het
Fbxl7 T A 15: 26,543,421 Y380F probably damaging Het
Gm3336 A G 8: 70,720,461 probably benign Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gm5134 T C 10: 75,976,366 Y152H probably damaging Het
Gm6899 A G 11: 26,593,795 probably benign Het
Gna11 T C 10: 81,544,873 K19E probably benign Het
Gpr15 C A 16: 58,717,885 L280F probably benign Het
Grhl3 T A 4: 135,559,104 K89* probably null Het
Ino80d C A 1: 63,086,329 probably benign Het
Irak3 T G 10: 120,145,782 K406T probably damaging Het
Kif15 G A 9: 122,999,210 C634Y probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Macrod2 A T 2: 140,395,716 E14V probably damaging Het
Matn3 T A 12: 8,955,374 D261E probably benign Het
Mdga1 A T 17: 29,857,736 probably benign Het
Natd1 G T 11: 60,913,656 R24S probably benign Het
Ncapd3 T A 9: 27,051,645 D415E possibly damaging Het
Parp9 T A 16: 35,953,736 Y81* probably null Het
Pde4d A G 13: 109,740,473 N73S probably benign Het
Pigb A T 9: 73,034,590 I129N probably damaging Het
Plxnb1 C A 9: 109,111,693 probably null Het
Ppfibp1 G T 6: 147,027,321 R813L probably damaging Het
Ramp3 T A 11: 6,658,619 L16Q unknown Het
Slc35a4 T C 18: 36,682,635 S173P probably benign Het
Slc41a1 T C 1: 131,844,377 V415A probably damaging Het
Smarcc2 CCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGC 10: 128,487,362 probably benign Het
Snph G A 2: 151,600,387 R43W probably benign Het
Sptan1 A T 2: 29,993,724 probably benign Het
Supt20 C A 3: 54,709,085 H254Q probably benign Het
Taar7a A G 10: 23,993,148 C112R probably damaging Het
Tbc1d4 T C 14: 101,507,572 Y206C probably damaging Het
Tecta A G 9: 42,337,208 V1961A probably damaging Het
Tgfbr1 T A 4: 47,383,948 Y30* probably null Het
Tmem71 C T 15: 66,555,214 S44N probably benign Het
Tnfrsf1b C A 4: 145,227,497 C94F probably damaging Het
Ttn A G 2: 76,749,396 Y23718H probably damaging Het
Ube2i T C 17: 25,265,294 probably benign Het
Vmn2r16 G T 5: 109,330,525 V49F probably benign Het
Vps45 A G 3: 96,046,371 I223T possibly damaging Het
Zfp955a T C 17: 33,242,618 Y180C probably benign Het
Zhx1 C G 15: 58,054,074 G259R probably damaging Het
Zscan18 T A 7: 12,775,289 probably benign Het
Other mutations in Olfr1453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Olfr1453 APN 19 13027591 missense probably damaging 0.98
IGL01137:Olfr1453 APN 19 13028030 missense possibly damaging 0.52
IGL01894:Olfr1453 APN 19 13028285 missense probably damaging 1.00
IGL02579:Olfr1453 APN 19 13027528 missense probably damaging 0.99
PIT4418001:Olfr1453 UTSW 19 13027731 nonsense probably null
R0099:Olfr1453 UTSW 19 13027801 missense probably damaging 1.00
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0211:Olfr1453 UTSW 19 13028282 missense possibly damaging 0.95
R0395:Olfr1453 UTSW 19 13028299 missense probably damaging 1.00
R0453:Olfr1453 UTSW 19 13027931 missense probably damaging 0.97
R0847:Olfr1453 UTSW 19 13027731 nonsense probably null
R1227:Olfr1453 UTSW 19 13027853 missense probably benign
R1823:Olfr1453 UTSW 19 13027817 missense probably benign 0.06
R2509:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2899:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R2964:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R2965:Olfr1453 UTSW 19 13028048 missense probably benign 0.38
R3157:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3158:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3409:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3410:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3411:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R3425:Olfr1453 UTSW 19 13028047 missense probably benign 0.03
R4018:Olfr1453 UTSW 19 13027825 missense probably benign
R4668:Olfr1453 UTSW 19 13028081 missense probably benign 0.00
R4805:Olfr1453 UTSW 19 13028297 missense probably benign 0.04
R5391:Olfr1453 UTSW 19 13027786 missense probably damaging 1.00
R5557:Olfr1453 UTSW 19 13027640 missense probably benign 0.01
R5740:Olfr1453 UTSW 19 13027562 missense probably benign 0.24
R7472:Olfr1453 UTSW 19 13028075 missense probably benign
R7832:Olfr1453 UTSW 19 13027996 missense probably benign 0.02
R7970:Olfr1453 UTSW 19 13027694 missense probably damaging 1.00
R8044:Olfr1453 UTSW 19 13027465 missense probably damaging 1.00
R8229:Olfr1453 UTSW 19 13028197 missense possibly damaging 0.55
Z1088:Olfr1453 UTSW 19 13028027 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACTTTAAAGGACTGTGCATGC -3'
(R):5'- AGCAGTCTCTATTTTCTATGGGAC -3'

Sequencing Primer
(F):5'- GCATGCACATCATGCATATA -3'
(R):5'- GGGACTATCATATTCATGTACTTGC -3'
Posted On2016-07-06